ID: 1144584454

View in Genome Browser
Species Human (GRCh38)
Location 17:16479680-16479702
Sequence TTTCGCTACAGCTCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144584454_1144584458 23 Left 1144584454 17:16479680-16479702 CCAGCAGCAGAGCTGTAGCGAAA 0: 1
1: 0
2: 0
3: 3
4: 110
Right 1144584458 17:16479726-16479748 CATGAAGCTTGCCCCTCGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1144584454_1144584457 22 Left 1144584454 17:16479680-16479702 CCAGCAGCAGAGCTGTAGCGAAA 0: 1
1: 0
2: 0
3: 3
4: 110
Right 1144584457 17:16479725-16479747 TCATGAAGCTTGCCCCTCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 44
1144584454_1144584456 -9 Left 1144584454 17:16479680-16479702 CCAGCAGCAGAGCTGTAGCGAAA 0: 1
1: 0
2: 0
3: 3
4: 110
Right 1144584456 17:16479694-16479716 GTAGCGAAAATCTAACATGGAGG 0: 1
1: 0
2: 0
3: 2
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144584454 Original CRISPR TTTCGCTACAGCTCTGCTGC TGG (reversed) Intronic
901056296 1:6450067-6450089 CTTAGCTTCAGCCCTGCTGCAGG - Intronic
911585479 1:99685349-99685371 TATCCCCACAGCTCTGCTGAAGG + Intronic
913075127 1:115335814-115335836 TTTCCCTGCTGCTCTGATGCAGG + Intronic
917444821 1:175098430-175098452 GTGCGCTACACCTCTGCTGGTGG + Exonic
917448042 1:175123498-175123520 GTGCGCTACACCTCTGCTGACGG + Exonic
918404602 1:184199377-184199399 TCTGGCTCCAGCTCTGCTGATGG - Intergenic
920516487 1:206588167-206588189 TTTGCCTGAAGCTCTGCTGCTGG + Intronic
920542656 1:206791257-206791279 ATTCCCAGCAGCTCTGCTGCTGG + Intergenic
922608544 1:226907120-226907142 TTCCTGTTCAGCTCTGCTGCTGG + Intronic
1064525839 10:16255796-16255818 TTTTTCTACAGCTCTTCTACAGG - Intergenic
1067237378 10:44462356-44462378 TTTCGCCACGTCTGTGCTGCTGG + Intergenic
1067764398 10:49074411-49074433 TTTCCAGCCAGCTCTGCTGCTGG - Intronic
1070779720 10:79130433-79130455 CCTGGCTGCAGCTCTGCTGCAGG - Intronic
1072792218 10:98326662-98326684 TCTAGCAACAGCTCTGCTGCAGG - Intergenic
1073398250 10:103236162-103236184 CTTCCCTGCAGCTCTCCTGCCGG - Intergenic
1076121554 10:127940568-127940590 TGTTGCTGCACCTCTGCTGCTGG + Intronic
1081613081 11:44575090-44575112 TTTCGCTTCAGCCCTACTGGTGG + Intronic
1081640218 11:44747955-44747977 TGACCCTGCAGCTCTGCTGCAGG - Intronic
1081643807 11:44776442-44776464 TTTCCCTACAGAGCTACTGCTGG + Intronic
1084521847 11:69668066-69668088 TTACACAACAGCTATGCTGCTGG + Intronic
1086650712 11:89286128-89286150 TTTCTCTTCAGCACTGCTGTGGG - Intronic
1090422825 11:126587345-126587367 TTCCCCTGCAGCTCTGCTCCAGG - Intronic
1090639923 11:128721544-128721566 TCTCTCTACAGCTCAGCAGCTGG - Intronic
1094689851 12:32757773-32757795 TTTCACTACAGCTCTTCTCTTGG - Intergenic
1096769281 12:53923872-53923894 TTTGGCATCACCTCTGCTGCTGG + Intergenic
1097339496 12:58421053-58421075 TTTAGCTTCATCTCTGCTGTAGG + Intergenic
1102728577 12:115088180-115088202 TGTCACTACAGCCCTGCTGAGGG - Intergenic
1103420611 12:120779301-120779323 TTTCCCTGCAGCTCTGGGGCTGG - Intronic
1103896945 12:124279361-124279383 TTCAGCTACAGCTCTGCTTGAGG - Intronic
1105015382 12:132783533-132783555 TCTCGCTTCAGCGCTGCTGGTGG - Intronic
1106672948 13:31927086-31927108 TTTCACTACACCGCTCCTGCTGG + Intergenic
1110087591 13:71401456-71401478 TTTCACTACAGATCTGATACTGG - Intergenic
1113102127 13:106732362-106732384 TTTGTACACAGCTCTGCTGCGGG - Intergenic
1113542255 13:111118030-111118052 CTTCGCTTGACCTCTGCTGCAGG + Intronic
1119086236 14:71741818-71741840 TTGCGCTCCAGATCTGGTGCCGG + Intergenic
1121567155 14:94918786-94918808 TTTCACTGCAGCCCTGCTGAGGG + Intergenic
1125788471 15:42343816-42343838 TTTTGCTCCAGCTCTTCTCCTGG - Intronic
1130919132 15:88329334-88329356 ATTCTCTGCACCTCTGCTGCTGG - Intergenic
1132198678 15:99932877-99932899 TTTCACTGAAGCTCTGCTGGGGG + Intergenic
1132320001 15:100919023-100919045 TTTCGCTATCCCTCTGCTCCAGG - Intergenic
1132508407 16:324287-324309 TTGCTCTACAGGTCTCCTGCCGG + Intronic
1133288875 16:4704806-4704828 CTTAGCTACATTTCTGCTGCAGG + Intronic
1134136599 16:11680505-11680527 TTTCCCTACAGCTTTGTTCCAGG + Intronic
1134694152 16:16210718-16210740 TTTCGAAACAGCTCTACTGGGGG - Intronic
1136025897 16:27469043-27469065 TTTAGTCACAGCTGTGCTGCAGG - Intronic
1139835506 16:69835199-69835221 TTTCACTACAGCTGTGCAGACGG - Intronic
1144094754 17:11889926-11889948 TGTCGGAACAGCTCTGGTGCTGG - Intronic
1144584454 17:16479680-16479702 TTTCGCTACAGCTCTGCTGCTGG - Intronic
1149084490 17:52698850-52698872 ATTTCCTACAGCTCTTCTGCTGG + Intergenic
1150764366 17:67992035-67992057 GCTCCCTACAGCTCTGCTCCAGG - Exonic
1151035165 17:70790692-70790714 TTTAACTACAGCTGTGCTTCTGG - Intergenic
1153716724 18:7857403-7857425 TTTCGATACAGCTGGGATGCTGG + Intronic
1154136857 18:11787356-11787378 TTTGGCAACAGCTATGGTGCTGG + Intronic
1156451125 18:37266964-37266986 TTTCCCCACAGCCCTTCTGCAGG - Intronic
1158748245 18:60226832-60226854 TTTCACTTCAGCCCTGCTACTGG + Intergenic
1159371966 18:67539603-67539625 TTTCACTACAGGTCTGTTTCTGG - Intergenic
1159481440 18:68995480-68995502 TTTAGCTACAGCTGGGATGCTGG - Intronic
1163678599 19:18668045-18668067 TCTCGGCACAGCTCTGCAGCCGG - Exonic
925783947 2:7410188-7410210 TTTTGCCACATTTCTGCTGCAGG + Intergenic
928140696 2:28726443-28726465 GTTCTCTATAGCTCTTCTGCTGG + Intergenic
933369813 2:81400068-81400090 TTGCTGTAAAGCTCTGCTGCAGG - Intergenic
933839683 2:86276360-86276382 TTTTCCTACTGCTCTGCTTCTGG + Intronic
935542796 2:104369407-104369429 CCTCTCTCCAGCTCTGCTGCTGG - Intergenic
937554046 2:123132263-123132285 TTTAGCCACAGCTGTGATGCAGG - Intergenic
938621213 2:133055748-133055770 TTTTCCTACAGCTCTGCATCTGG - Intronic
939735913 2:145844552-145844574 TGTAGTTACAGCTCTGTTGCTGG - Intergenic
942147847 2:173043796-173043818 TTTCCCTCAAGCTCTGATGCAGG - Intronic
943932382 2:193869940-193869962 TTTTGCTATAGGTATGCTGCTGG + Intergenic
944474454 2:200089441-200089463 TTTCACTACAGCTCTAATGAAGG + Intergenic
947036710 2:225866920-225866942 TTTAGCTACAGCAATGCTCCTGG - Intergenic
1170533560 20:17317927-17317949 ATTCTCTTCATCTCTGCTGCAGG - Intronic
1184734228 22:46388656-46388678 TTTCGTTGTGGCTCTGCTGCAGG - Intronic
950304056 3:11904882-11904904 TTTTCCTTCAGCTCTCCTGCAGG + Intergenic
950441270 3:13012113-13012135 TTTCCTTACAGCCTTGCTGCTGG + Intronic
960982762 3:123246947-123246969 TTTACGAACAGCTCTGCTGCTGG - Intronic
963474749 3:145790900-145790922 GTTTGCTACAACTCTGCTACAGG + Intergenic
967562604 3:190934525-190934547 TATCGCTTCAGCTCTGCTAAGGG - Intergenic
968231319 3:197006451-197006473 TTTCTCTAGAGGTCTGCTCCAGG + Intronic
968564354 4:1302910-1302932 TTTTGCTACAGCCCTTCTGGTGG - Intronic
970770636 4:19607982-19608004 TGTCGCAGTAGCTCTGCTGCAGG + Intergenic
983264684 4:165495654-165495676 GTTCCTTACAGCCCTGCTGCTGG + Exonic
984191762 4:176614071-176614093 TTTAGCAAAAGCTCTGATGCAGG + Intergenic
984598074 4:181694249-181694271 TTTGGCTCCAGGTCTGCTGCTGG + Intergenic
989928970 5:49920850-49920872 TTTCACAACTGCTCTGCTGAAGG - Intergenic
990012241 5:51013465-51013487 TTTCTCCACAGCTTTGCTGGGGG + Intergenic
990310968 5:54537894-54537916 CTTTGTTACAGCTCTGCAGCTGG + Intronic
993006672 5:82435444-82435466 TTTCATTACAGCTCTGAGGCAGG - Intergenic
993617455 5:90131293-90131315 TTTCTCAGCTGCTCTGCTGCTGG - Intergenic
993810000 5:92464238-92464260 TTTGGCTGCATCTCTGCTGAAGG + Intergenic
996128395 5:119752601-119752623 TTTTGCTACAGAACTGCTGCAGG + Intergenic
996297959 5:121945843-121945865 TTTAACTACAGCTGTGCTTCTGG + Intergenic
996742864 5:126817808-126817830 TTTCTCTCCTGCTCTGTTGCAGG + Intronic
1005090074 6:22047187-22047209 TTTGGCAATAGCTCTGCTCCAGG + Intergenic
1007262089 6:40571049-40571071 TTCCTCTCCAGCTCTGCTTCCGG - Intronic
1012211376 6:96522158-96522180 TTTCGCTGCAGCTGGGCTGGGGG - Intronic
1015440738 6:133242735-133242757 TTTCGCCCCAGCTCTGCCACCGG - Intronic
1015502512 6:133949061-133949083 TTTCACTACATCTCTGAGGCAGG - Intergenic
1016533290 6:145082744-145082766 TGTGGCTACAACTCAGCTGCTGG + Intergenic
1016592047 6:145756587-145756609 TTTCGTTAGAGCCCTGCTTCAGG - Intergenic
1017225172 6:152012907-152012929 TTTTGCTGCAACTCTGCTCCAGG - Intronic
1017564150 6:155666293-155666315 TCTCCCTGCAGCTCTGCCGCAGG - Intergenic
1019292830 7:258684-258706 TGCCGCTACAGCAGTGCTGCAGG + Exonic
1029582865 7:101449005-101449027 TTTTCCTTCAGCTCTGCTGTGGG - Intronic
1030295348 7:107920550-107920572 TTTAGCTTTAGCTATGCTGCTGG + Exonic
1038098910 8:24349931-24349953 TTTCTCTGGAGCTCTGGTGCCGG - Exonic
1043134711 8:76506818-76506840 TTTGCCTACACCTCTCCTGCTGG - Intergenic
1053397618 9:37788472-37788494 TTTGGCTTCAGCTCTGCATCAGG + Intronic
1054453573 9:65417351-65417373 TTTCAATAAATCTCTGCTGCTGG + Intergenic
1055992433 9:82121455-82121477 TTTCATTAAAGCTCTGCTCCTGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1061515397 9:131087080-131087102 TATCTCCCCAGCTCTGCTGCTGG + Intronic
1186010979 X:5132774-5132796 TTTTGCTACATCTATGCTTCTGG + Intergenic
1196285180 X:113871489-113871511 TTTAGCCACAGCTATGATGCAGG - Intergenic
1197572563 X:128166985-128167007 TTTATCTACATCACTGCTGCAGG + Intergenic