ID: 1144584608

View in Genome Browser
Species Human (GRCh38)
Location 17:16480731-16480753
Sequence CTGTAGCAGGAGAAGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 1, 2: 3, 3: 60, 4: 561}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144584608_1144584617 -6 Left 1144584608 17:16480731-16480753 CCCATCTCCTTCTCCTGCTACAG 0: 1
1: 1
2: 3
3: 60
4: 561
Right 1144584617 17:16480748-16480770 CTACAGGGAAGGGGCAGCACAGG 0: 1
1: 0
2: 4
3: 25
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144584608 Original CRISPR CTGTAGCAGGAGAAGGAGAT GGG (reversed) Intronic
900773804 1:4566458-4566480 TTGCAGCAGGAGAGGGAAATAGG - Intergenic
901107206 1:6765809-6765831 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
901439753 1:9270670-9270692 CTGTTGCAGGAGAACTAGACGGG + Exonic
901881676 1:12197761-12197783 CTGTGGCAGGAGGAGCAGGTGGG - Intronic
903161574 1:21492723-21492745 CTGTGGCAGGCAAATGAGATTGG + Intergenic
903428603 1:23273864-23273886 CTGGAAGAGGAGGAGGAGATGGG + Intergenic
903596941 1:24502561-24502583 GGCTAGCAGGAAAAGGAGATCGG + Intronic
904406659 1:30294982-30295004 CTGTAACAGAAAAAGGAAATAGG + Intergenic
905317318 1:37091586-37091608 ATGTAGGAGGTGAAGGAGAAAGG - Intergenic
905386180 1:37605892-37605914 CTGGAGCAGGACACTGAGATGGG - Intergenic
905417608 1:37815161-37815183 CTGCAGGGGGAGGAGGAGATGGG - Exonic
906223776 1:44104277-44104299 CTGAAGCTGGAGACGGAGCTTGG - Intergenic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907542706 1:55230466-55230488 CTCTGCCAGGAGATGGAGATTGG + Intergenic
908003727 1:59707391-59707413 CTGTAGGAGGAGGGGGAGAGAGG + Intronic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
910501768 1:87900590-87900612 ATGAAGAAGGAGAAAGAGATGGG - Intergenic
911175690 1:94815619-94815641 CTGGAGCAGGAGAGAGACATGGG - Intergenic
914350532 1:146835973-146835995 CTGCTGCAGGAGAGGGAGCTGGG - Intergenic
914360418 1:146931054-146931076 TTGTAGCTTGAGAAGGAGCTGGG + Intergenic
914493329 1:148168844-148168866 TTGTAGCTTGAGAAGGAGCTGGG - Intergenic
914773361 1:150712497-150712519 CTGTAGAAGGAGATTAAGATTGG - Intronic
914964093 1:152237710-152237732 CGGGGGCAGGAGAAAGAGATGGG - Intergenic
915622977 1:157097530-157097552 CTGGGGCAGGTGAAGGAGGTGGG - Intronic
915825654 1:159073237-159073259 CTTCAGGAGGAGAAGGAGAAAGG - Exonic
916572174 1:166037563-166037585 CTGTAGGAGGAGACAGAAATGGG + Intergenic
916797509 1:168180322-168180344 CAGGAGGAGGAGAAGCAGATGGG + Intronic
916880593 1:169016499-169016521 TTGCAGCAGGAGTAGGAGAAAGG - Intergenic
917333892 1:173909290-173909312 CTGTATCAGGTAGAGGAGATGGG - Intronic
917335246 1:173918885-173918907 CTATAGCAGGGCAAGGATATAGG + Intergenic
917588459 1:176452464-176452486 GTGTAGCAGGAGAGGCAGAGAGG + Intergenic
918157374 1:181862169-181862191 CTGGATCAGGAAAATGAGATAGG + Intergenic
918344373 1:183593419-183593441 CTGCAGCATGGGAAGGAGTTCGG - Intronic
918722816 1:187875592-187875614 CTGGAGCAGGAGAAATAGAGGGG + Intergenic
918739957 1:188117074-188117096 GTGTAACAGTAGAAGGTGATGGG - Intergenic
918851170 1:189692665-189692687 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
920543077 1:206793898-206793920 GAGTAGCAGGGGAAGGAGAGTGG + Intergenic
920564967 1:206965859-206965881 CTGCAGCAAAGGAAGGAGATGGG + Intronic
924049968 1:240070777-240070799 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
924186888 1:241502174-241502196 CAGCAGCATGAGAAGGAGACAGG + Intronic
924291126 1:242537559-242537581 CTGGAGGAGTAGGAGGAGATAGG - Intergenic
924637857 1:245805898-245805920 CTGAAGCAGTAGAAGGAACTTGG - Intronic
924823593 1:247518044-247518066 CTGTGGCAGGAGGTGGAGAAGGG - Intronic
924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG + Exonic
1064234973 10:13565371-13565393 CCGGAGCAGGAGCAGGGGATGGG - Intergenic
1065624851 10:27619829-27619851 CTGGAGCAGGAGAGAGAGACGGG + Intergenic
1065752728 10:28902527-28902549 CAATGGAAGGAGAAGGAGATAGG + Intergenic
1065786436 10:29220089-29220111 CTGGAGCAGGAGGAAGAGAGGGG - Intergenic
1066142805 10:32524970-32524992 CTTGAACAGGAGAAAGAGATGGG - Intronic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1067019123 10:42780041-42780063 CTGGAGCAGGAAAAGGTGGTGGG + Intergenic
1067415150 10:46097071-46097093 CTGTAGCAGGGTAAAGAGAGAGG - Intergenic
1067466489 10:46502957-46502979 CTGGACCAGGAGCAGGAGCTGGG + Intergenic
1067620699 10:47881648-47881670 CTGGACCAGGAGCAGGAGCTGGG - Intergenic
1067770116 10:49116562-49116584 CTGTAGGAGGAGGAGGAGACAGG + Intergenic
1068914095 10:62409603-62409625 CTGAAGCACAAGAAGGAAATGGG - Intronic
1069323633 10:67204377-67204399 CTGGAGCAGGAGGAAGAGAGAGG - Intronic
1070338131 10:75472946-75472968 CTTTGGCATGAGAAGGAGATTGG + Intronic
1070397684 10:76025780-76025802 CTGGGGCTGGTGAAGGAGATGGG - Intronic
1070433079 10:76360769-76360791 CTGTAGCAGGTGAGGGAGGGAGG - Intronic
1070581808 10:77725959-77725981 AGGAAGCAGGAGCAGGAGATGGG - Intergenic
1070983077 10:80665888-80665910 CTGTATGAGGAAAAGAAGATGGG - Intergenic
1071444539 10:85733406-85733428 CTGTAACTGGAGAAGAAGATGGG + Intronic
1071691699 10:87826951-87826973 CTGTAGAATGAGGAGGAAATGGG - Intronic
1072463988 10:95646335-95646357 CTGTATCAGGAGAAGAGGGTGGG + Intronic
1072820225 10:98549517-98549539 CTGTAGCAGGATAAGGAAATAGG - Intronic
1073396830 10:103224938-103224960 CTGGAGCAAGAGGAAGAGATCGG + Intergenic
1075358073 10:121801821-121801843 CTCTAGCAGGAGTAGGAGGATGG - Intronic
1075378241 10:121996987-121997009 CTGGAGAAGGAGAAAGAGAGTGG + Intronic
1075957847 10:126539224-126539246 CTTTAGCAGGAAAAGCAAATCGG + Intronic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078385830 11:10891713-10891735 TTGAAGAAGGAGAAGAAGATGGG + Intergenic
1078906831 11:15695558-15695580 CCATAGCAGGAGAAGGAGGGAGG + Intergenic
1079619815 11:22540174-22540196 CTCTAGTGGTAGAAGGAGATAGG + Intergenic
1079844304 11:25445626-25445648 CTGAAGCCTGAGAAGGAGCTCGG + Intergenic
1080431317 11:32202660-32202682 CTGTAGGAGGAGAGTGAGAGGGG + Intergenic
1080599598 11:33809115-33809137 ATGAGGCAGGAGGAGGAGATTGG + Intergenic
1080929084 11:36788535-36788557 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
1080946549 11:36980744-36980766 CTAGAGCAGGAGAAAGAGAAGGG + Intergenic
1081239832 11:40691389-40691411 CTTTAACAGGACCAGGAGATGGG + Intronic
1081441618 11:43086954-43086976 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1081620290 11:44615266-44615288 CTGCAGCTGAAGCAGGAGATGGG + Exonic
1081622832 11:44629055-44629077 CTGAGGGAGGAGAAGGAGTTAGG - Intergenic
1081634829 11:44714152-44714174 CTGGAGCAGAATAAGCAGATGGG + Intergenic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1082273841 11:50200451-50200473 CTGTGTCAGGATGAGGAGATTGG - Intergenic
1082644799 11:55709418-55709440 CTGAAGCAAGAGGAAGAGATGGG - Intergenic
1083208643 11:61168698-61168720 CTGATGCAGGGGAAGGAGATGGG - Intergenic
1084343892 11:68529862-68529884 TTGTAGCTGTGGAAGGAGATGGG + Intronic
1085651023 11:78268806-78268828 CTGAAGGAGGAAAAGGAGACAGG - Intronic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086775143 11:90821365-90821387 CTGAAAAAGGAGAAAGAGATGGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087165712 11:95000217-95000239 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1087168703 11:95028649-95028671 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1087245423 11:95829985-95830007 ATGTAGAAGGAGAGGGAGTTAGG + Intronic
1087594743 11:100238490-100238512 CAGCAGCAGGAGGAGGAGAAGGG + Intronic
1088233841 11:107701360-107701382 CTTTAGCAGGGGAAAGGGATAGG - Intergenic
1088989311 11:114938025-114938047 GTGGAGCAGGAGAAAGAGAGAGG - Intergenic
1089522124 11:119071932-119071954 CCGGAGTAGGAGTAGGAGATTGG - Intronic
1090448947 11:126789274-126789296 CTTGAGAAGGCGAAGGAGATGGG - Intronic
1090568142 11:128018473-128018495 GTATAGAAAGAGAAGGAGATAGG + Intergenic
1090606161 11:128424831-128424853 CTGTAGCGGGAGACAGAGAAAGG - Intergenic
1090908081 11:131094750-131094772 CTGTGGAAAGAGAAGGAGTTGGG + Intergenic
1091512560 12:1144060-1144082 AAGTAGAAGGAGAAGGAAATGGG - Intronic
1091644826 12:2265507-2265529 GTGTGGGAGGAGAATGAGATAGG - Intronic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1094472332 12:30815057-30815079 CTGAAGCAGGAGAATCAGTTGGG - Intergenic
1095135378 12:38594842-38594864 CTGTAGCTGGAAAAGGATGTGGG - Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1097053824 12:56238648-56238670 CTGGAGCTGGAGAAGGGGGTAGG + Exonic
1097088446 12:56487073-56487095 CTGTAGCAGGAACAGGAAATGGG - Intronic
1097410223 12:59243334-59243356 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1098139030 12:67432688-67432710 ATGTGGCAGGTGAAGGAGAAGGG - Intergenic
1098227368 12:68338629-68338651 CTGCAGTAGGAGAAGGAGGTTGG - Intergenic
1098758003 12:74389549-74389571 CTGAAGCTGGATAAGGAGGTCGG + Intergenic
1099328270 12:81247419-81247441 ATGTAACAGCAGAATGAGATAGG + Intronic
1099947343 12:89259503-89259525 ATGCAGCAGGACAGGGAGATGGG - Intergenic
1100278038 12:93090002-93090024 CGGAAGCAGGAGCAGGAGTTGGG - Intergenic
1101682728 12:106985327-106985349 CTGGTGCAGGAGAGGGAAATGGG - Exonic
1102441382 12:112966404-112966426 CTGCAGCAGGTGGAGGAGGTGGG - Intronic
1102658258 12:114501926-114501948 GGGGAGCAGGAGAAGGAGAAAGG + Intergenic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103620816 12:122186140-122186162 CTGTAGCAGGAGAGGGAGCACGG - Intronic
1104594659 12:130112953-130112975 CTGTAGGAGGAGCAGGTGATAGG - Intergenic
1104757358 12:131277474-131277496 CTGCAGGAGGAGGAGGAGTTGGG + Intergenic
1104775688 12:131389000-131389022 CTGCAGGAGGAGGAGGAGTTGGG - Intergenic
1105347753 13:19589502-19589524 TTGAAGCAGGAGTAGGAGTTAGG - Intergenic
1106345337 13:28871718-28871740 GTACAGCAGGATAAGGAGATAGG + Intronic
1106803476 13:33281248-33281270 CTGAAGTAGGATAAGGAGACAGG - Intronic
1107167427 13:37298984-37299006 CAGAAGCAAGAGAAAGAGATGGG + Intergenic
1107480122 13:40779309-40779331 TTGAAGCAGGAGGAGGAGTTAGG - Intergenic
1107649643 13:42531688-42531710 CTTTAGAAGAAGAGGGAGATGGG - Intergenic
1108058560 13:46509670-46509692 ATGGAGCAAGAGAGGGAGATGGG - Intergenic
1108106225 13:47013689-47013711 CTGTATCAGCTGAAGGAGATGGG + Intergenic
1108129375 13:47280844-47280866 TTGCAGCAGGAGATAGAGATAGG - Intergenic
1108160568 13:47633848-47633870 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1109040780 13:57333589-57333611 CTGAAACAGGAGAAGGGGATAGG + Intergenic
1109093127 13:58073324-58073346 CTGTAGCAGGAGGAACAGAGAGG - Intergenic
1109391104 13:61694857-61694879 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1110231223 13:73169448-73169470 CTGAAGCATGAGAGAGAGATGGG + Intergenic
1110484482 13:76022034-76022056 CTGTAGAAGGAGGAAGAAATTGG + Intergenic
1110796742 13:79647026-79647048 CTTCAGCAGGAGGAGGACATAGG - Intergenic
1111175909 13:84596085-84596107 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1111296927 13:86291231-86291253 CTGTAGCAGGAGTAAGAGGGTGG - Intergenic
1111735590 13:92135050-92135072 CTGCAGCAGGAGAACCAGAGAGG - Intronic
1111746018 13:92270413-92270435 CAGGAGCAGGAGAAAGAGAGAGG - Intronic
1111873795 13:93867673-93867695 GTGGAGCAGGAGAAGCAAATAGG - Intronic
1111973385 13:94940518-94940540 CAGCAGCAGGAGAAGGCCATGGG + Intergenic
1112924788 13:104660903-104660925 CTGTAGCCTGGGAAGGAGCTGGG + Intergenic
1115121250 14:29940713-29940735 CTGGAGCAGGAGGATGAGTTGGG - Intronic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1115813269 14:37133686-37133708 CTGGAGGAGGGGAAGGAGACAGG - Intronic
1116072507 14:40066783-40066805 CTGAAGCAGGAGGAAGAGAGAGG + Intergenic
1116475344 14:45332794-45332816 CAGGAGCAGTAGAGGGAGATTGG + Intergenic
1116690024 14:48093889-48093911 ATGGGGCAGGAGAAAGAGATAGG + Intergenic
1118264973 14:64286210-64286232 TGGTAGCTGGAGAAGGATATAGG + Intronic
1118326408 14:64784470-64784492 CTGCAGAAGGAGAAGGCCATGGG + Intronic
1119083622 14:71720235-71720257 ATGTAGCGAGAGAAGGAGATCGG - Intronic
1119181018 14:72605289-72605311 CAGGAGCAGGAGGAGGGGATGGG + Intergenic
1119346715 14:73931112-73931134 CTCAAGTAGGAGAAGGAAATAGG - Intronic
1120008864 14:79390422-79390444 CTGTAGCAGCAGAAAGAGGTAGG - Intronic
1120105876 14:80493819-80493841 CTATAGCAGGAGAAGCCAATAGG + Intronic
1120260370 14:82176940-82176962 TTGTACAAAGAGAAGGAGATTGG - Intergenic
1120381184 14:83781788-83781810 CTGTAGCAGGAGAGACTGATAGG - Intergenic
1120953726 14:90063526-90063548 CTGGAGCAGGGGAGGGAGGTTGG + Intronic
1121584752 14:95055578-95055600 CTGTACAAGGAGCAGGTGATGGG + Intergenic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1123435565 15:20251608-20251630 CTGTTGCATGAGAAGAAGAAAGG - Intergenic
1123675190 15:22703730-22703752 CTGTAGCAGGAGACCCAGAGAGG - Intergenic
1123681621 15:22768238-22768260 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681640 15:22768322-22768344 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681679 15:22768490-22768512 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681707 15:22768637-22768659 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681722 15:22768700-22768722 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681738 15:22768805-22768827 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681759 15:22768889-22768911 CAGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681831 15:22769243-22769265 CTGAAGCAGAAGGAGCAGATGGG - Intergenic
1123681840 15:22769306-22769328 CGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123681851 15:22769348-22769370 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1123681930 15:22769810-22769832 CGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123681982 15:22770101-22770123 CAGGAGCAGGAGGAGCAGATGGG - Intergenic
1124333839 15:28842710-28842732 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1124333848 15:28842752-28842774 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1124333857 15:28842794-28842816 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1124333915 15:28843121-28843143 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
1124529192 15:30488617-30488639 CTGCAACAGGAGAACGAGAGAGG - Intergenic
1124769470 15:32519076-32519098 CTGCAGCAGGAGAACGAGAGAGG + Intergenic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1126896358 15:53261230-53261252 CTGGAGTAGGAGAAGCAGACTGG + Intergenic
1127014381 15:54666956-54666978 TTGTAGCAGGGAAAGGAGAAAGG + Intergenic
1127771260 15:62232642-62232664 TTGTAGCAAGAGTAGGAGGTGGG + Intergenic
1128171477 15:65517449-65517471 CCGGCGCAGGAGAAGGAGAAGGG + Intronic
1128257211 15:66205787-66205809 CTCTGGCAGGGGAAGGAGGTGGG - Intronic
1128892267 15:71342036-71342058 CTGTAACAGGAGATGGGGAGGGG + Intronic
1129816692 15:78561669-78561691 CTGAAGGAGGAGTAGGAGTTAGG + Intergenic
1131618818 15:94045371-94045393 CTGTAGCAGGAGATGGAACATGG - Intergenic
1131853403 15:96566534-96566556 CTGTAGAAGGAGAGGGGGCTGGG - Intergenic
1131885022 15:96903175-96903197 GAGGAGCAGTAGAAGGAGATTGG - Intergenic
1132524394 16:407149-407171 CTGCAGCAGGGGCAGGACATGGG + Intronic
1132917047 16:2355153-2355175 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1133191970 16:4140488-4140510 CAGAAGCAGGAGAAAGAGAGAGG - Intergenic
1133809059 16:9147190-9147212 CTGTAGCAGGAGAACATCATTGG + Intergenic
1133910211 16:10059061-10059083 CTGTAACAGGAGAAGAACTTGGG + Intronic
1133936033 16:10270122-10270144 TTGCAGTAGGAGAACGAGATTGG - Intergenic
1134395271 16:13856668-13856690 CTGCAGCAGGAGAAAGTGCTGGG - Intergenic
1134592057 16:15462534-15462556 CTGCAGTGGGAGAAGGTGATTGG + Intronic
1134818654 16:17227743-17227765 ATGGAGCAGGAGAAAGAGTTGGG + Intronic
1135490017 16:22900951-22900973 CTGTCGCAGGAGCAGGTGAAGGG + Intronic
1136309489 16:29397839-29397861 CTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136577421 16:31132771-31132793 ATGTAGCGGGAGAAGGTGATGGG + Exonic
1136849041 16:33599387-33599409 CTGTTGCATGAGAAGAAGAAAGG + Intergenic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137910385 16:52372417-52372439 CTCTACCAGGAGGAGGAGAAAGG + Intergenic
1137942990 16:52707263-52707285 CTGAAGGAGGAGCAGGAGGTAGG - Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138371629 16:56531505-56531527 CTGGAGCAGAAAAAGGACATTGG + Intergenic
1138835418 16:60428983-60429005 CTTTTGCAGTAGAAGCAGATAGG + Intergenic
1139752948 16:69120203-69120225 ATGAAGCTGGAAAAGGAGATGGG + Exonic
1139983506 16:70879566-70879588 CTGCTGCAGGAGAGGGAGCTGGG + Intronic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1141094168 16:81151051-81151073 CTTTAGCAGGGCAAGGAGAGAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1203110748 16_KI270728v1_random:1448037-1448059 CTGTTGCATGAGAAGAAGAAAGG + Intergenic
1143130855 17:4676080-4676102 CCGAAGCTGGAGAAGGACATGGG + Exonic
1143216462 17:5228892-5228914 CTATAGCAGGGGAAAGAGACTGG - Intronic
1143455782 17:7066792-7066814 CTGAAGCAGGAGAAAGAAACTGG + Intergenic
1143616603 17:8054971-8054993 CTGTTGCTTGAGAAGGAGAGTGG + Intergenic
1144227442 17:13163390-13163412 CTGGAGCAGGAGCAAGAGATGGG + Intergenic
1144235498 17:13256820-13256842 CTCTGGCAGGAGAATGAAATTGG + Intergenic
1144555546 17:16279634-16279656 CTGGAGCAAGAGAAGGACAATGG - Intronic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1145904638 17:28509417-28509439 ATGGAGCAGGAGGTGGAGATGGG - Intronic
1145979772 17:29004761-29004783 CTGCAGCGGGAGAAGGACGTGGG + Intronic
1146457004 17:33016234-33016256 TTGTTGCAGGAGATGGAGCTAGG + Intronic
1149066423 17:52485921-52485943 CAGGAGGAGGAGGAGGAGATGGG - Intergenic
1149478905 17:56985948-56985970 CTGTAAAGGGAGAAGGATATGGG - Intronic
1150456527 17:65310881-65310903 CTGAAGGAGGAGAAGGAGCTAGG + Intergenic
1150490106 17:65568529-65568551 CTGAAGCAGGAGAATGACATGGG - Intronic
1150666090 17:67139918-67139940 ATGTAGCAGGAGATGGGGGTTGG - Intronic
1151356139 17:73559739-73559761 CTCTAGCAGGACAGGGAGGTAGG - Intronic
1151664840 17:75540004-75540026 CTGTAGAAGGAGCAAGAGCTTGG - Intronic
1151868071 17:76818059-76818081 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152331693 17:79677322-79677344 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1152611744 17:81318247-81318269 CTTTAGCAAGGGAGGGAGATGGG - Intronic
1153362306 18:4211101-4211123 CTGAAGCTCGAGAATGAGATGGG + Intronic
1153466110 18:5389525-5389547 CTGTGGCTGGAGAAGTAGGTGGG + Intergenic
1153770302 18:8409796-8409818 CTGTCGCAGTAGAAGGTGTTAGG - Intergenic
1155661826 18:28258393-28258415 TTGTAGCAAGGGAAGAAGATCGG - Intergenic
1157431114 18:47627315-47627337 GTGAAGCAGGGGAAGGATATAGG + Intergenic
1158536949 18:58316748-58316770 CTGAAGCTGGAATAGGAGATGGG - Intronic
1159691249 18:71491063-71491085 GTGAATCAGGAGCAGGAGATGGG + Intergenic
1160066433 18:75578885-75578907 CTGTAGAAGGGGAGGGAGTTAGG - Intergenic
1162264076 19:9555916-9555938 CCGAAGCAGGAGCAGGAGAGAGG + Intergenic
1162722901 19:12673010-12673032 CTGAAGCAGGTGCAGGTGATGGG - Exonic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1164424542 19:28129217-28129239 CAGCAGCAGGAGAAAGAGAGAGG - Intergenic
1165004767 19:32795838-32795860 CTGGAGCAGGAGCAGGAGCAGGG + Intronic
1165721053 19:38080032-38080054 GTGGAGCAGGGGAAGGAGTTTGG + Intronic
1165740626 19:38203294-38203316 CTGCAGCTGCAGAGGGAGATGGG - Intronic
1166562122 19:43739903-43739925 GTGTAGAAGGCGAATGAGATGGG + Intronic
1166897791 19:46035009-46035031 CTATAGCAGGGGAAGGAAGTTGG + Intergenic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167448405 19:49552963-49552985 CCGTAGCAGAAGAAAGAGACGGG - Intergenic
1167463381 19:49638103-49638125 CCTGAGCAGGAGAAGGAGACGGG - Intronic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167591536 19:50406911-50406933 GTGGAGCAGGAGAAGGAAGTGGG - Intronic
925291018 2:2748788-2748810 CTGTGGCTGGAGGAGGAGCTGGG + Intergenic
925839647 2:7979588-7979610 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
926336514 2:11866556-11866578 GAGTGGCAGGAGAAGCAGATGGG + Intergenic
926576202 2:14584924-14584946 CTGTAGTAGGAGCTGGGGATGGG - Intergenic
927167037 2:20333937-20333959 CTGTAGCAGGAGGAAGAGAGGGG - Intronic
927679317 2:25129621-25129643 CTTCAGAAGGAAAAGGAGATGGG - Intronic
928411838 2:31060394-31060416 CTGTGGCAGGAGTGGGACATTGG - Intronic
929253418 2:39782999-39783021 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
930122956 2:47774823-47774845 CTGTAGTAGGAGAAGTTGAAGGG + Intronic
930253684 2:49064641-49064663 TGGTAGCTGGAGAAAGAGATGGG + Intronic
930635586 2:53802144-53802166 ATGTATCAGGAGACAGAGATAGG - Intronic
930940799 2:57012494-57012516 CTGGAGCAGGAGGAAGAGTTGGG - Intergenic
930941046 2:57014520-57014542 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
931447205 2:62336620-62336642 GGGTAGCAGGAGATGGGGATGGG - Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
932300866 2:70666131-70666153 GTGTAGAAGGGGGAGGAGATAGG - Intronic
932498847 2:72162434-72162456 CTGTAGATGGAGAAGCAGTTAGG - Intergenic
932594382 2:73085173-73085195 CTGTGGCAGCGGAAGGAGCTTGG - Intronic
933309942 2:80648044-80648066 CTGTAGCCTGGGAAGGAGACAGG + Exonic
933502874 2:83138874-83138896 AAGGAGCAGGAGAAGGAGAAGGG + Intergenic
934308568 2:91844382-91844404 CTGTAGAAAGAGAAGGTGAGGGG - Intergenic
934882553 2:97996144-97996166 CTGGCGCAGGAGAAGGAGGGAGG + Intergenic
935269233 2:101419420-101419442 CTGTGGAAGGAAAAGGAGACTGG + Intronic
935369688 2:102332270-102332292 TTGGAGCAGGTTAAGGAGATGGG + Intronic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936732407 2:115400025-115400047 CTGGAGCAGGAGCAAGAGACGGG + Intronic
937791460 2:125967052-125967074 TTGGAGCAGAAGGAGGAGATTGG - Intergenic
937931664 2:127209890-127209912 CTGGAGCACCAGAAGGAGACGGG + Intronic
939059335 2:137400849-137400871 CTGGAGCAGGGGAAGAAGGTAGG + Intronic
939809126 2:146809409-146809431 CTGGAGTACCAGAAGGAGATGGG + Intergenic
940124252 2:150306688-150306710 CAGTATCTGGAGAAGGAGATAGG - Intergenic
940269299 2:151874001-151874023 CTGGAGCAGGAGGAAGAGACGGG - Intronic
940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG + Intergenic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941408650 2:165124936-165124958 CTGAAGCAGGGGAAGGCAATTGG - Intronic
943502891 2:188713943-188713965 CTGGAACAGGAAAAGGACATTGG - Intergenic
943539086 2:189189234-189189256 CTCTATCAGGAGAAGAAGAGAGG - Intergenic
945013200 2:205486627-205486649 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
945030542 2:205659277-205659299 CGGTAGAAGTAGAAAGAGATGGG - Intergenic
947022270 2:225693132-225693154 CTGGAGCAGGAAAAGAACATTGG - Intergenic
947181408 2:227414695-227414717 CTGTATCTGGAGATAGAGATAGG + Intergenic
948074882 2:235158289-235158311 CTGAAGCAAGAGACAGAGATGGG - Intergenic
948078993 2:235190085-235190107 CTGGAGCCGAAGGAGGAGATGGG - Intergenic
948590008 2:239043214-239043236 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
948995441 2:241576024-241576046 CTGCAGTGGGAGAAGGAGAGTGG - Intergenic
949036046 2:241816176-241816198 CTGTAGAAGGCGAAGGAGTGAGG - Exonic
949060026 2:241951383-241951405 GTGAAGCAGGAGAAGAAAATAGG - Intergenic
1168760085 20:344627-344649 CTGTAGAAGGCGAAGGGGAAGGG - Intergenic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1169121769 20:3100937-3100959 CTGAAGCGGGAGGAGGAGGTTGG - Intergenic
1169518538 20:6345456-6345478 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1169846316 20:9996008-9996030 CTGGAGCACAAGAAGGACATAGG + Intronic
1170417394 20:16159075-16159097 CTGTAGGGGGAGAAGGAAGTGGG - Intergenic
1170426220 20:16237823-16237845 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1170641929 20:18162112-18162134 CCAGAGAAGGAGAAGGAGATGGG - Exonic
1171084360 20:22223755-22223777 CAGTAGCTGGACAAGGCGATCGG - Intergenic
1171491754 20:25524400-25524422 CTGTAGGAGGGGATGGAGCTGGG + Intronic
1172447674 20:35001678-35001700 CTGTTCCATGAGAAGGAGCTAGG - Intronic
1172845780 20:37929305-37929327 CTGTGGCAGGAGTAGGAGCAGGG + Intronic
1173411922 20:42818926-42818948 CTGAAGTAGCAGAAAGAGATGGG + Intronic
1173951456 20:46996848-46996870 CTGGAGCAGGAGGAAGAGAGGGG + Intronic
1174406435 20:50306166-50306188 ATGAAGCAGGAAAAGGAGATGGG + Intergenic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1175777555 20:61662841-61662863 CTGTAGGCGGACATGGAGATAGG - Intronic
1175919671 20:62444791-62444813 CTGGGGCAGGAGAAGGAGGGTGG + Intergenic
1176081366 20:63274950-63274972 CTGCTGCAGGACAAGGAGAGTGG - Intronic
1176115024 20:63428436-63428458 CTGGGGCAAGAGAAGGAGAGGGG + Intronic
1178056369 21:28803470-28803492 CTGTAGCAGTAGATTGAGATTGG - Intergenic
1178377719 21:32081723-32081745 CTGGAGGAGGCTAAGGAGATAGG - Intergenic
1178507838 21:33177221-33177243 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1178853206 21:36230268-36230290 CCAAAGCAGGAGAAGGAGAGCGG - Intronic
1179175298 21:39003758-39003780 CTTTAGCAGTGGAAGAAGATGGG - Intergenic
1180138475 21:45876430-45876452 CTGGAGCAGGGGAAGGTGAGCGG + Intronic
1180516248 22:16147689-16147711 CTTGAGCAGGAGAAGGATCTGGG - Intergenic
1181828477 22:25539349-25539371 CTGGAACAGAAGAAGGAGATTGG - Intergenic
1182177723 22:28309547-28309569 CCATAGAAGGAGAAGCAGATAGG - Intronic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182428689 22:30288109-30288131 CAGCAGCAGGAGGAGGAGCTAGG + Intronic
1182996294 22:34815959-34815981 CTGGAGCAGGAGAAAGAGACGGG + Intergenic
1183252032 22:36737100-36737122 CTGTGGCAGGCGAGGGAGATAGG - Intergenic
1183269166 22:36850017-36850039 CTGTGGCAGGCCAAGGAGACAGG + Intergenic
1183485382 22:38085376-38085398 CTGTAGGAGGAGAGAGAGAATGG + Intronic
1184058259 22:42066741-42066763 CAGCTGCAGGAGAAGGCGATGGG + Exonic
1184437831 22:44490334-44490356 CTGGAGCAGGTGCAGGAGAGAGG + Intergenic
1184675478 22:46040460-46040482 CTGTAGCAGGCCAGGGACATGGG + Intergenic
1184956404 22:47889718-47889740 CTGGAGCAGGAGAAAGAGAGAGG - Intergenic
949110527 3:255012-255034 TTGTAGCTAGAGATGGAGATAGG - Intronic
949847120 3:8383039-8383061 CTGTAGCAGGAGTGGCAGAGAGG + Intergenic
950009406 3:9712299-9712321 CAGTAGCATGAGAAAGACATGGG - Intronic
950297673 3:11846271-11846293 CTAGAGCAGGAGAAGCAGTTAGG - Intronic
950360931 3:12448869-12448891 GTGAAGCAGGACAAGGAGAAGGG - Intergenic
950529443 3:13544663-13544685 CTGGAGCAGGGGATGGGGATGGG + Intergenic
952979044 3:38720599-38720621 CAGTCCCAGGGGAAGGAGATGGG + Intronic
954714467 3:52520258-52520280 CGGCTGCAGGAGAAAGAGATGGG - Exonic
955079156 3:55641716-55641738 CAGTAGAAGGAAAAGGAGAGAGG - Intronic
955080570 3:55654703-55654725 CTTTGGCACGAGAAGGAGACCGG + Intronic
955683435 3:61526467-61526489 CTGTGGCAGAAGGAGGAAATAGG - Intergenic
956367494 3:68520411-68520433 CTGTAGCACAAGAAAGAAATTGG - Intronic
957911174 3:86621527-86621549 ATGAAGCAGCAGAAGGAAATAGG + Intergenic
959171709 3:102852147-102852169 CTGGAGCAGGAGAAAGGGAATGG - Intergenic
959559823 3:107767046-107767068 CTGTCGCAGGATAGGGAGCTAGG + Intronic
960397432 3:117154352-117154374 CAGTATCCGGAGAAGGATATAGG - Intergenic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
961073581 3:123961334-123961356 CTGGAGCAGGAGAAAGGGAGTGG - Exonic
961453970 3:127015304-127015326 CCGTACCAGGAGAAGGAGCAGGG - Exonic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
962051558 3:131821095-131821117 CTGAAGGAGGAGGAGGAGGTTGG + Intronic
962324532 3:134422462-134422484 CAGGAGCAAGAGAAGGAGAGGGG - Intergenic
963284342 3:143418484-143418506 TTGTAACAGGAGAAGGAGATGGG + Intronic
963867565 3:150379032-150379054 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
966107975 3:176360662-176360684 TCGAAGCAGGGGAAGGAGATTGG + Intergenic
966275689 3:178164663-178164685 CTGTAGAAGGAGAATAAAATAGG + Intergenic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
967832560 3:193933005-193933027 CTGTTGCAGGAGGAGAAGAGGGG + Intergenic
969295642 4:6269538-6269560 CTGTTACAGGAGAAGGCGAGCGG + Intergenic
969624640 4:8296197-8296219 CTGTCTCAGGAGAAAGAGAGAGG - Intronic
969715510 4:8866313-8866335 GTGAAGCAGGACAGGGAGATGGG + Intronic
970413610 4:15835170-15835192 AAGTAGGAGGAGGAGGAGATAGG - Intronic
970421928 4:15913014-15913036 AGGAAGCAGGAGAAGGAAATTGG + Intergenic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971725312 4:30304187-30304209 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
971934687 4:33132511-33132533 CTGAAGCAGGAGACAGAGTTTGG + Intergenic
973846854 4:54921574-54921596 CTGGAGCAGGAGCAAGAGAGAGG - Intergenic
973849356 4:54945924-54945946 CTGAAGCAGGAGAGGGCGAGAGG - Intergenic
974421819 4:61685528-61685550 CTGAAGAATGAGAACGAGATAGG + Intronic
974517270 4:62934105-62934127 CTGGAGCTGGAGAAGTAGGTAGG - Intergenic
974672499 4:65050471-65050493 CTGAAGCAGGAGAAGGACTGCGG - Intergenic
975423883 4:74203603-74203625 CTGGAGCAGGAAGAAGAGATGGG + Intronic
975519409 4:75283287-75283309 CTGTAGCATTAGAAGGATTTAGG + Intergenic
975568173 4:75782836-75782858 CTGTAGCATTAGATGTAGATTGG - Exonic
975621877 4:76304950-76304972 ATGGAGCAGGGGAAGGATATAGG + Intronic
976434273 4:84999092-84999114 TTGTAACAGGAGAATGACATGGG + Intergenic
978269920 4:106876663-106876685 GTGGAGCAGGAGAGGGAGAGGGG - Intergenic
978669479 4:111228788-111228810 CTGAACCAGGAGAAGCAGACTGG - Intergenic
979198121 4:117944061-117944083 CTGAAGCAGGAGGAAGAGAGAGG + Intergenic
979345674 4:119584135-119584157 CTGGAGCAGGAGAAAGAAGTAGG + Intronic
980716819 4:136638563-136638585 CTGAAGCAGGATAGGGAGGTGGG - Intergenic
980888899 4:138793224-138793246 CTGCAGCAGGAGGAAGAGAGAGG - Intergenic
982325128 4:154122158-154122180 ATGAAGGAGGAGAATGAGATGGG - Intergenic
982553214 4:156828296-156828318 CTGTATCAGAAGAGTGAGATGGG - Intronic
982643554 4:157993383-157993405 CTGTAGAAGGAAAAAGATATTGG + Intergenic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
983568061 4:169175411-169175433 GTGTAGCAGGAGTAGGATGTAGG - Intronic
984029123 4:174581523-174581545 CTGAAGCTTGAGAAGGAGAGAGG - Intergenic
984121118 4:175745807-175745829 CTGAGGCTGGAGAAGGAGATGGG + Intronic
985285521 4:188332947-188332969 CTGGAACAGGAGAAGGAGCTTGG + Intergenic
985386560 4:189453721-189453743 CTGAAGAAGGAGAAGGGAATTGG + Intergenic
986392620 5:7300297-7300319 CGGAAGCAGGAGAAGCAGATGGG - Intergenic
986392666 5:7300591-7300613 CTGAAGCAGAAGAAGCAGATGGG - Intergenic
986392747 5:7301032-7301054 CGGAAGCAGGAGGAGCAGATGGG - Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986815733 5:11407988-11408010 GGGAGGCAGGAGAAGGAGATTGG + Intronic
986990849 5:13551311-13551333 CTGTGGCAGGAAATGGAGAGTGG + Intergenic
987256161 5:16154002-16154024 ATGTATCAGGACAACGAGATAGG + Intronic
988194873 5:27992152-27992174 CTGGAGTAGGAGAAGGAATTAGG - Intergenic
988327982 5:29796167-29796189 CTTGAGCAGGATATGGAGATAGG - Intergenic
988448354 5:31312821-31312843 GTGAGGCAGAAGAAGGAGATAGG - Intronic
988815088 5:34826766-34826788 CTGTTGCAGAAAAAGGAGAAGGG - Intronic
989762857 5:45040138-45040160 ATATTGCAGAAGAAGGAGATAGG + Intergenic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
991247598 5:64524771-64524793 CTGAAGCAGGAGAGGGAGAGAGG - Intronic
992365079 5:76083047-76083069 TTGTAGCAGGTGAAGGAGAGGGG - Intergenic
992843093 5:80715727-80715749 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
993066512 5:83105382-83105404 CTGGGGCAGAGGAAGGAGATTGG + Intronic
994662212 5:102667618-102667640 CAGTAGCAGCAAAATGAGATTGG + Intergenic
994758112 5:103819333-103819355 CTGAGGCAGGAGAGGGAGACAGG + Intergenic
995797192 5:115954017-115954039 GTGTAACTGGAGATGGAGATTGG + Intergenic
996232966 5:121088501-121088523 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996416326 5:123214566-123214588 CTGTGGGAGGTGAAGGAGAGGGG - Intergenic
996674586 5:126159232-126159254 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
997691877 5:135832770-135832792 CAGTAGCAGGACATGCAGATGGG - Intergenic
998053196 5:139053490-139053512 TTGAAGCAGGAGAATGACATAGG - Intronic
998400247 5:141844938-141844960 CAGTGGCAGGAGGAGGGGATTGG + Intergenic
999261304 5:150240548-150240570 CGGTACCAAGAGAAGGAGAGGGG + Intronic
999439955 5:151593358-151593380 CTATTGCAGGAGGGGGAGATGGG + Intergenic
1000089463 5:157917703-157917725 TTGTAGTAGGGGAGGGAGATTGG - Intergenic
1000579437 5:163017136-163017158 CTGGAGCAAGAGAACGAGAAAGG - Intergenic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1002076690 5:176712639-176712661 CTGGGGCAGGAGAGGGAGGTGGG + Intergenic
1003093251 6:3121991-3122013 ATGTAGAAGAAAAAGGAGATGGG + Intronic
1003818056 6:9863759-9863781 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
1004069921 6:12288612-12288634 CTGAAGCAAGAGTTGGAGATGGG - Intergenic
1004272784 6:14210691-14210713 GTGTAGCAGGTGGAGGAGACAGG - Intergenic
1006181294 6:32154821-32154843 CTGTGGCAGGGGAGGGAGAGCGG + Intronic
1006429692 6:33988146-33988168 CAGGACCAGGAGAAGGAGCTTGG - Intergenic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1006697369 6:35942326-35942348 CTGAAGGATGAGTAGGAGATAGG - Intergenic
1007044602 6:38759908-38759930 TTGTAGCAGGAAAGAGAGATTGG - Intronic
1007239784 6:40416725-40416747 CCCTAGCAGGAGAAGGAGGAAGG - Intronic
1007870683 6:45034145-45034167 CTGTTGGAGGAGGAGGAGGTAGG - Intronic
1008541436 6:52549703-52549725 CTGGGGCAAGAGAAGGAAATGGG + Intronic
1010289216 6:74115964-74115986 CTGAAGAAGGAAAAAGAGATTGG - Intergenic
1011140546 6:84150875-84150897 CTGTAGGAGGAGAATGAGCATGG - Intronic
1011623414 6:89263838-89263860 GTGTAGCTGCAGAAGGAAATTGG - Intronic
1011626861 6:89290280-89290302 CTGTGGCAGGAAAAGAAGAAAGG - Intronic
1011647080 6:89469924-89469946 CTGTAGAAGGAGAAGAATCTGGG - Intronic
1011975060 6:93285715-93285737 ATGTGGCAAGAGAAGGAGACAGG - Intronic
1012674780 6:102101686-102101708 CTAGAGCAGGAGAAAGAGAGAGG + Intergenic
1014773652 6:125484741-125484763 CTGTAGCTGAGGAAGAAGATGGG + Intergenic
1015053137 6:128865959-128865981 CTGCAATAGGAGAAAGAGATTGG - Intergenic
1015292987 6:131559664-131559686 CTGAGGCAGGAGAATGAGAATGG - Intergenic
1016460911 6:144279432-144279454 CAGTAGTAGGAGCAGGAGAGGGG + Intergenic
1016697560 6:147015809-147015831 GTGTAGCAGCACAAGGACATGGG - Intergenic
1017690166 6:156956155-156956177 CTCTAGCAGGGGAAGGAGGTGGG + Intronic
1018248160 6:161841941-161841963 TTGCAGCAGGGGAAGGAGATTGG - Intronic
1018278994 6:162164305-162164327 CTGAGGCAGGAGATGGAGATGGG - Intronic
1018633365 6:165839793-165839815 ATGGAGCTGGAGAAGGGGATGGG - Intronic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1019113373 6:169736930-169736952 TTGGAGTAGCAGAAGGAGATGGG - Intergenic
1019135058 6:169902727-169902749 GTGTAGCTGTAGAAGGGGATGGG - Intergenic
1019701364 7:2476337-2476359 CTGGACCTGGAGAAGGAGAACGG - Intronic
1019779207 7:2929758-2929780 CTGCAGCAGGAGAGGGTGTTGGG + Intronic
1019816364 7:3204039-3204061 CTGGAGCAGGAGGAGGAGAGAGG + Intergenic
1020017109 7:4837463-4837485 CTGTTGCAGGAGCAGGCCATCGG - Intronic
1020795297 7:12671573-12671595 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
1021414990 7:20373717-20373739 CTTCAGCAGGGGAAGGAGAAGGG - Intronic
1022282015 7:28920453-28920475 GAGACGCAGGAGAAGGAGATGGG - Intergenic
1022662376 7:32379066-32379088 CTGGAGCAGGAGAGGTAGGTAGG - Intergenic
1023137229 7:37064738-37064760 CTGCAGATGGGGAAGGAGATAGG - Intronic
1023689830 7:42774283-42774305 CTGGAGCAGGAGGTGGAAATTGG - Intergenic
1024438921 7:49392070-49392092 CTCTAGCACAAGAAGGAGAAGGG + Intergenic
1024924599 7:54599729-54599751 CTGTAGCAGGACACTGATATTGG - Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026892491 7:73990432-73990454 TTTAAGCAGGAGAATGAGATGGG - Intergenic
1027505846 7:79016514-79016536 CTGTGGTAGGAGAAGGGCATAGG - Intronic
1028424940 7:90676231-90676253 TTAAAGCAGGAAAAGGAGATAGG + Intronic
1029000657 7:97151311-97151333 CTGTAGCTGCAGAAAGAAATAGG + Intronic
1029039652 7:97559044-97559066 TTGGAGTACGAGAAGGAGATTGG + Intergenic
1030196448 7:106858109-106858131 ATGTAGCAGGAAAAGGAGGGTGG + Intergenic
1030434697 7:109502015-109502037 CTCTAGCAGGAGAAGGAGATAGG + Intergenic
1030516552 7:110545306-110545328 TGGTAGCAGGAGAGAGAGATGGG - Intergenic
1030579450 7:111335021-111335043 CTGTAGCAGGAGCAGTTTATAGG + Intronic
1030711757 7:112757956-112757978 CTCTAGCTGGGGAAGGAAATAGG - Intergenic
1031080842 7:117255572-117255594 CTGGAGGAGGAGAAAGAGAGGGG - Intergenic
1031150666 7:118050350-118050372 CAGAAGCAGGGAAAGGAGATTGG - Intergenic
1031368608 7:120935825-120935847 ATGTAGCAGAAGCAGGAGGTAGG + Intergenic
1031511194 7:122651962-122651984 CTGGAGTATGAGCAGGAGATGGG - Intronic
1031599200 7:123684944-123684966 ATGGAGCAGGAAAAGAAGATTGG - Intronic
1031818365 7:126469093-126469115 CTTTATTAGGTGAAGGAGATGGG - Intronic
1031874486 7:127122972-127122994 CAGGAACAGGAGAAGAAGATGGG + Intronic
1032606283 7:133357862-133357884 CTGTGGCAGGAGAAGGATAAAGG - Intronic
1032691750 7:134294394-134294416 CTGAAGAAGGAAAAGGTGATGGG + Exonic
1032932494 7:136689757-136689779 CTGAAGCTGGAGAATTAGATCGG - Intergenic
1032978190 7:137249981-137250003 CTGCAGAAGGTGATGGAGATTGG - Intronic
1033245052 7:139710869-139710891 CTGGAGAAGGAGAAAGAGAGAGG - Intronic
1033385926 7:140874930-140874952 CTGGAGCAGAAGCAAGAGATGGG - Intronic
1033462970 7:141564159-141564181 ATGTGGCATGAGAGGGAGATAGG - Intronic
1034204845 7:149306403-149306425 CTGGAGGAGGAGAGGGAGCTGGG + Intergenic
1035057537 7:156046097-156046119 CAGGAGCAGGAGCAGGAGAGAGG + Intergenic
1035109706 7:156470927-156470949 CGGGAGCAGGAGCAGGAGAGCGG - Intergenic
1035850990 8:2919167-2919189 ATGCTGCAGGAGAAGGAGAAAGG - Intergenic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036495038 8:9262635-9262657 CTGAGGCAGGAGCAGGAGAATGG - Intergenic
1037019091 8:13945921-13945943 CTGTAGCCATAGAAGGAGACAGG - Intergenic
1037628439 8:20629431-20629453 CTGGGCCAGGAGAAGGACATTGG + Intergenic
1038713136 8:29967183-29967205 CTGGAGCAGGAGGAAGAGCTGGG + Intergenic
1038776360 8:30534574-30534596 CTAGAGCAGGAGAAGGCCATGGG + Intronic
1038935071 8:32240921-32240943 ATGTTGCAAGAGAAGGAGAATGG + Intronic
1038971301 8:32638821-32638843 AAGCAGCAGGAAAAGGAGATTGG + Intronic
1039186979 8:34928579-34928601 CTGTAGCTGGAGAGGAGGATGGG + Intergenic
1039823592 8:41154873-41154895 GTTTAGCAGGGGAAGGAGAGAGG + Intergenic
1039866773 8:41511825-41511847 CTGCAGCTGGAGACAGAGATGGG + Intergenic
1040408024 8:47127849-47127871 CTGTAGCTGGGGAAGAATATTGG - Intergenic
1040672156 8:49704587-49704609 TTGTAGGAGGGGAAAGAGATTGG - Intergenic
1040799225 8:51322642-51322664 ATGTAGCAGGTAGAGGAGATTGG + Intronic
1041166572 8:55098314-55098336 CTGTAGCTGGAGAAGGGGCGTGG - Intergenic
1041216448 8:55606349-55606371 CTGGAGAAGGAGGAGGAGAGAGG - Intergenic
1042069774 8:64918836-64918858 TTGAAGGAGGAGAAAGAGATAGG + Intergenic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1043509374 8:80934258-80934280 CAGTCACAGGAGAAGGTGATAGG - Intergenic
1043993401 8:86783324-86783346 CTATAGGAGGTGAAGGAAATGGG + Intergenic
1044250453 8:89999682-89999704 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
1044825679 8:96194647-96194669 CTGTATTTGGAGAAGGAGTTTGG + Intergenic
1045629695 8:104104013-104104035 CTGAAGATGGAGGAGGAGATGGG + Intronic
1046138683 8:110062382-110062404 CTGAAGCTGGATAGGGAGATGGG - Intergenic
1046629671 8:116610898-116610920 CTGCAGCGGGAGAGAGAGATTGG + Intergenic
1046836079 8:118803077-118803099 CTGTAGGAGGGGAAGCAGATGGG + Intergenic
1047184162 8:122616959-122616981 CTCTAGCAGGAAATGGAGCTAGG - Intergenic
1047552371 8:125888996-125889018 CTGGAACAGAAGAAGGATATAGG - Intergenic
1047920317 8:129628572-129628594 CTGTGGCACGGGCAGGAGATAGG - Intergenic
1048194614 8:132322034-132322056 GTGTGGCAGAAGAAGGAGAGCGG + Intronic
1048392097 8:133976796-133976818 CAGGAGCAGGAGAGAGAGATGGG - Intergenic
1048705442 8:137148091-137148113 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1048985114 8:139730945-139730967 CTGGGGGAGGAGGAGGAGATGGG + Exonic
1049122521 8:140751811-140751833 TTGTAGCAGGACAAGGGGAATGG + Intronic
1049174224 8:141181571-141181593 TGGTGGCAGGAGAAGGAAATGGG + Intronic
1049681892 8:143922688-143922710 CGGAAGCAGGCGGAGGAGATCGG - Exonic
1049860440 8:144894525-144894547 CTGGTGCAGGAGAAAGGGATAGG - Intronic
1050388382 9:5112647-5112669 CTGGTGCAGGATAAGGAGTTTGG - Intronic
1050670825 9:7995562-7995584 CTGAGGCAGGAGATGGAGATGGG - Intergenic
1050910502 9:11063447-11063469 CTCTGGCAGGAGAAGGTGGTGGG + Intergenic
1050937827 9:11421176-11421198 CACTAGCAAGAGAAGGAGGTAGG + Intergenic
1051339146 9:16094986-16095008 CCAGAGCAGGAGGAGGAGATGGG - Intergenic
1051530466 9:18096484-18096506 CTGTGGCCAGAGTAGGAGATGGG + Intergenic
1052204050 9:25816605-25816627 CAGGAGCATGAGAAGCAGATTGG - Intergenic
1052379026 9:27750107-27750129 ATGTACCAGGAGAAGGAAACTGG - Intergenic
1052695168 9:31869063-31869085 CTGTACCAGTAGCAGCAGATTGG + Intergenic
1053706071 9:40753670-40753692 CTTGAGCAGGAGAAGGATCTGGG + Intergenic
1053852394 9:42301951-42301973 CTGTTGCAGGAGAACAATATGGG - Intergenic
1054416147 9:64877274-64877296 CTTGAGCAGGAGAAGGATCTGGG + Intergenic
1054876772 9:70105911-70105933 CTGTAGCATGTAAAGGAGGTAGG - Intronic
1055503520 9:76925380-76925402 TTGCAGCAGGGGAGGGAGATTGG - Intergenic
1055661404 9:78507402-78507424 CTCTAGCAGGAGAATGAAAAAGG + Intergenic
1055770576 9:79712773-79712795 GAGTAGCAGGTGAAGGAGAAGGG - Intronic
1056482952 9:87024303-87024325 CAGTAGCAAGAGAAAGAGAAGGG + Intergenic
1056605010 9:88078299-88078321 TTGTAGCAGGAGATGGACATTGG + Intergenic
1058058651 9:100473593-100473615 GTGTAGCAGCAGAAGGCGAGCGG - Exonic
1058374463 9:104306439-104306461 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1058407003 9:104688025-104688047 ATCTAGCTGGAGTAGGAGATAGG + Intergenic
1058853601 9:109037584-109037606 CTGGAGCAGGAGGAAGAGAGGGG - Intronic
1059767093 9:117393865-117393887 ATGGAGGAGGAGGAGGAGATGGG + Intronic
1059889248 9:118783042-118783064 TTGTAGCAGGAGAAAGAGATGGG + Intergenic
1060284903 9:122241848-122241870 CTGTAGCAGCAAAAGCAAATTGG - Exonic
1060625848 9:125110618-125110640 CTGGAGCAGGAGCAAGAGAGTGG - Intronic
1061616252 9:131781386-131781408 CTGTAGCAGTAGAACCAGCTTGG + Intergenic
1061668800 9:132176346-132176368 CAGGGGCAGGGGAAGGAGATGGG - Intronic
1062212929 9:135374209-135374231 CTGGAGCAGGAGAAACAGATTGG - Intergenic
1186502885 X:10066184-10066206 CTGTATCAGGCTAAGGAGATTGG + Intronic
1186568434 X:10689316-10689338 TTGGAGCAGGAGAAAGAGAGAGG + Intronic
1186572430 X:10729264-10729286 CTTTAGCAGGACAAAGAGAGAGG - Intronic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1189263921 X:39699305-39699327 CAGGAGCAGGACCAGGAGATGGG + Intergenic
1189386340 X:40539811-40539833 CTGTAGGAGGAGGAGGAAGTGGG - Intergenic
1189958830 X:46305998-46306020 ATGTAGCAGGAGAGAGAGAGAGG + Intergenic
1190446074 X:50525783-50525805 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1193322127 X:80135049-80135071 CAGTAACTGGATAAGGAGATGGG - Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194165208 X:90507045-90507067 CTGGAGCTGGAAAAGGAAATTGG + Intergenic
1194259093 X:91671693-91671715 TTGTAGCAGGAGATGTGGATAGG - Intergenic
1195368474 X:104149837-104149859 CTTAAGCAGGAGAAGTACATGGG - Intronic
1195768279 X:108319785-108319807 CTGTAGCCAGAGAGGGACATGGG + Intronic
1196279192 X:113802923-113802945 CTCTGGCAGGAGCAGGAGGTCGG - Intergenic
1196791139 X:119466133-119466155 CTGTACCAGAAAAAGGACATTGG - Intergenic
1196798761 X:119523613-119523635 CTATAGGAGGAGAGGGGGATAGG + Intergenic
1196940116 X:120767258-120767280 CTAAAGCAAGATAAGGAGATGGG + Intergenic
1197689825 X:129486224-129486246 CTGTGCCAGGAAAAGGACATTGG - Intronic
1197941788 X:131797817-131797839 CTGTACCAGGAGAAGGGAACTGG - Intergenic
1198018508 X:132635472-132635494 CTGTAGCATGTGGAGGAGCTTGG - Intronic
1198144240 X:133838993-133839015 TTCCAGCAGGAGAAGGAAATAGG + Intronic
1199049576 X:143221366-143221388 CTGGAGCAGGAGGAAGAGATGGG - Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199539342 X:148941672-148941694 CTGAAGCTGAAGAAGGAGTTGGG + Intronic
1199927185 X:152480048-152480070 CTGAAGCTGGAGACGGAGCTTGG + Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200511471 Y:4084854-4084876 CTGGAGCTGGAAAAGGAAATTGG + Intergenic
1200577791 Y:4910890-4910912 TTGTAGCAGGAGATGTGGATAGG - Intergenic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1200735351 Y:6788092-6788114 CTATATCAGGCTAAGGAGATTGG + Intergenic
1200915306 Y:8566155-8566177 CTGTAGGATGAGAAGCAGAAAGG + Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1202117653 Y:21486987-21487009 TAGTAGGAGGAGAAGGACATAGG - Intergenic