ID: 1144585994

View in Genome Browser
Species Human (GRCh38)
Location 17:16488131-16488153
Sequence TAACCTTCCGCCATTGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 45}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144585994_1144586000 22 Left 1144585994 17:16488131-16488153 CCTCTCTCAATGGCGGAAGGTTA 0: 1
1: 0
2: 1
3: 1
4: 45
Right 1144586000 17:16488176-16488198 AGACAGCAGGCCTGAGCCCAAGG 0: 1
1: 0
2: 3
3: 34
4: 429
1144585994_1144585995 -10 Left 1144585994 17:16488131-16488153 CCTCTCTCAATGGCGGAAGGTTA 0: 1
1: 0
2: 1
3: 1
4: 45
Right 1144585995 17:16488144-16488166 CGGAAGGTTATTTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 99
1144585994_1144585998 9 Left 1144585994 17:16488131-16488153 CCTCTCTCAATGGCGGAAGGTTA 0: 1
1: 0
2: 1
3: 1
4: 45
Right 1144585998 17:16488163-16488185 CAGGGCTCCTTAAAGACAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 153
1144585994_1144586002 24 Left 1144585994 17:16488131-16488153 CCTCTCTCAATGGCGGAAGGTTA 0: 1
1: 0
2: 1
3: 1
4: 45
Right 1144586002 17:16488178-16488200 ACAGCAGGCCTGAGCCCAAGGGG 0: 1
1: 0
2: 1
3: 25
4: 253
1144585994_1144586001 23 Left 1144585994 17:16488131-16488153 CCTCTCTCAATGGCGGAAGGTTA 0: 1
1: 0
2: 1
3: 1
4: 45
Right 1144586001 17:16488177-16488199 GACAGCAGGCCTGAGCCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 237
1144585994_1144585996 -9 Left 1144585994 17:16488131-16488153 CCTCTCTCAATGGCGGAAGGTTA 0: 1
1: 0
2: 1
3: 1
4: 45
Right 1144585996 17:16488145-16488167 GGAAGGTTATTTCTTCTCCAGGG 0: 1
1: 0
2: 2
3: 24
4: 241
1144585994_1144586003 28 Left 1144585994 17:16488131-16488153 CCTCTCTCAATGGCGGAAGGTTA 0: 1
1: 0
2: 1
3: 1
4: 45
Right 1144586003 17:16488182-16488204 CAGGCCTGAGCCCAAGGGGAAGG 0: 1
1: 0
2: 5
3: 47
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144585994 Original CRISPR TAACCTTCCGCCATTGAGAG AGG (reversed) Intronic
903736206 1:25531281-25531303 TGACCTGCCGCCCTTGGGAGGGG - Intergenic
906035409 1:42747590-42747612 TACCCTTCCCCCATCCAGAGGGG - Intronic
906709976 1:47922225-47922247 TAGCCTACTGCCATGGAGAGTGG + Intronic
1080876484 11:36279489-36279511 TAACCTTCCACCAGTGAGAGTGG + Intronic
1083216250 11:61222164-61222186 TAACCTTGCACCATGGGGAGGGG - Intergenic
1083219132 11:61240990-61241012 TAACCTTGCACCATGGGGAGGGG - Intergenic
1093806662 12:23441455-23441477 TCACCTTCCGTATTTGAGAGTGG + Intergenic
1100258139 12:92904968-92904990 TGACCTTCAGGCATAGAGAGGGG - Intronic
1100668718 12:96785832-96785854 TAACCTTCAGCTATTGAGGTAGG + Intronic
1103917158 12:124381845-124381867 TAACCTTCGGCCATAAGGAGGGG + Intronic
1108514554 13:51188173-51188195 TAGCCTTCAACCATTCAGAGTGG - Intergenic
1111578467 13:90190362-90190384 TCACCTTCCTCCTTTGACAGAGG - Intergenic
1117640843 14:57797961-57797983 TAACCTCCTGCCATTGCCAGAGG + Intronic
1120893571 14:89510100-89510122 TAATCTTCCCCCATGGTGAGAGG - Intronic
1126195502 15:45926339-45926361 TAACCCTGCGCCATTGACTGTGG + Intergenic
1137764167 16:50964923-50964945 TAACCTTCAGCTAGTGAGACAGG - Intergenic
1138966292 16:62087922-62087944 TAACTTTCTGCCATTGGTAGTGG + Intergenic
1139337177 16:66240997-66241019 TCTCCTCCTGCCATTGAGAGGGG - Intergenic
1140348189 16:74235191-74235213 TAAACTTCAGCAATTGACAGAGG + Intergenic
1144585994 17:16488131-16488153 TAACCTTCCGCCATTGAGAGAGG - Intronic
1154004792 18:10517789-10517811 TGACCCTCTTCCATTGAGAGGGG - Intergenic
1163378985 19:16951925-16951947 TAGCCTTCCTCCATTCAGTGGGG - Intronic
925450458 2:3965052-3965074 TACCTTTTCTCCATTGAGAGTGG + Intergenic
933647244 2:84822686-84822708 GAACCATCCTCCATTGACAGAGG - Intronic
937729795 2:125214809-125214831 TAACCTTCTTCTGTTGAGAGGGG + Intergenic
945652986 2:212587980-212588002 TAACCTTTTGCCAATGATAGTGG + Intergenic
1173071941 20:39776605-39776627 TAACCTTCTCCCCTTGAGTGTGG + Intergenic
1177066558 21:16444050-16444072 TAACCTTCAGCACTTGAGTGAGG + Intergenic
951077908 3:18419314-18419336 TAACCTTCCAGCATTTAAAGGGG + Intronic
958523043 3:95216036-95216058 AAACCTTCATCCTTTGAGAGAGG - Intergenic
984319452 4:178172978-178173000 TAATCTTCTGACATTGACAGAGG - Intergenic
985220003 4:187694036-187694058 TAACCGTCCAACATTGAGACAGG + Intergenic
992292827 5:75297262-75297284 AAACCTTCATTCATTGAGAGAGG - Intergenic
1003130000 6:3387223-3387245 TAACCTTCCTCAGTTGAGATGGG - Intronic
1004384401 6:15159897-15159919 TGACCTTCCTCCACTGAGACAGG - Intergenic
1034686340 7:152974551-152974573 TTACCCTTCCCCATTGAGAGAGG - Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1041472540 8:58226336-58226358 TAATCTTGCCCCAGTGAGAGGGG + Intergenic
1042709126 8:71695566-71695588 TAGCCATCCTCCAATGAGAGGGG + Intergenic
1044729081 8:95215897-95215919 TAACCTTCTGTGGTTGAGAGAGG + Intergenic
1051108090 9:13603671-13603693 TAAGCTGCCGCCACTGAAAGTGG - Intergenic
1056634180 9:88318119-88318141 TAACCTTGCGCCCTTGAGGGTGG + Intergenic
1188027064 X:25220942-25220964 GTACCCTCCGACATTGAGAGTGG + Intergenic
1188246301 X:27840031-27840053 TACCCTTCCACCATTGAGGTTGG + Intergenic
1195010332 X:100727476-100727498 TACCCTTTCACCATTGCGAGTGG - Intronic
1195303818 X:103558639-103558661 TCACCTTCTGCAGTTGAGAGGGG + Intergenic
1199244143 X:145583324-145583346 TAACCTTCCACCTCTGAGGGTGG - Intergenic
1201413966 Y:13729276-13729298 CAACCTTCCTCTATAGAGAGAGG + Intergenic