ID: 1144590597

View in Genome Browser
Species Human (GRCh38)
Location 17:16520603-16520625
Sequence GTGCAGGTTGATAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144590588_1144590597 23 Left 1144590588 17:16520557-16520579 CCTAGTCCGGATCATAATCTAGA No data
Right 1144590597 17:16520603-16520625 GTGCAGGTTGATAGGGAGGCTGG No data
1144590591_1144590597 -3 Left 1144590591 17:16520583-16520605 CCTCACTGCATCTCACCACTGTG No data
Right 1144590597 17:16520603-16520625 GTGCAGGTTGATAGGGAGGCTGG No data
1144590590_1144590597 -2 Left 1144590590 17:16520582-16520604 CCCTCACTGCATCTCACCACTGT No data
Right 1144590597 17:16520603-16520625 GTGCAGGTTGATAGGGAGGCTGG No data
1144590589_1144590597 17 Left 1144590589 17:16520563-16520585 CCGGATCATAATCTAGAAGCCCT No data
Right 1144590597 17:16520603-16520625 GTGCAGGTTGATAGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144590597 Original CRISPR GTGCAGGTTGATAGGGAGGC TGG Intergenic
No off target data available for this crispr