ID: 1144596152

View in Genome Browser
Species Human (GRCh38)
Location 17:16571779-16571801
Sequence CCATCTCAGAATCTATTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144596150_1144596152 -7 Left 1144596150 17:16571763-16571785 CCTTGTATGCAATTCTCCATCTC No data
Right 1144596152 17:16571779-16571801 CCATCTCAGAATCTATTTATAGG No data
1144596149_1144596152 3 Left 1144596149 17:16571753-16571775 CCAGTAATTACCTTGTATGCAAT No data
Right 1144596152 17:16571779-16571801 CCATCTCAGAATCTATTTATAGG No data
1144596148_1144596152 4 Left 1144596148 17:16571752-16571774 CCCAGTAATTACCTTGTATGCAA No data
Right 1144596152 17:16571779-16571801 CCATCTCAGAATCTATTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144596152 Original CRISPR CCATCTCAGAATCTATTTAT AGG Intergenic
No off target data available for this crispr