ID: 1144599203

View in Genome Browser
Species Human (GRCh38)
Location 17:16598145-16598167
Sequence CTGGCCAAACTGATCTACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144599197_1144599203 8 Left 1144599197 17:16598114-16598136 CCTGAGACCCCGTAGCTCCAACA No data
Right 1144599203 17:16598145-16598167 CTGGCCAAACTGATCTACCTTGG No data
1144599199_1144599203 0 Left 1144599199 17:16598122-16598144 CCCGTAGCTCCAACACAGAAAGT No data
Right 1144599203 17:16598145-16598167 CTGGCCAAACTGATCTACCTTGG No data
1144599195_1144599203 22 Left 1144599195 17:16598100-16598122 CCTGAAACCTTGCTCCTGAGACC No data
Right 1144599203 17:16598145-16598167 CTGGCCAAACTGATCTACCTTGG No data
1144599200_1144599203 -1 Left 1144599200 17:16598123-16598145 CCGTAGCTCCAACACAGAAAGTC No data
Right 1144599203 17:16598145-16598167 CTGGCCAAACTGATCTACCTTGG No data
1144599196_1144599203 15 Left 1144599196 17:16598107-16598129 CCTTGCTCCTGAGACCCCGTAGC No data
Right 1144599203 17:16598145-16598167 CTGGCCAAACTGATCTACCTTGG No data
1144599202_1144599203 -9 Left 1144599202 17:16598131-16598153 CCAACACAGAAAGTCTGGCCAAA No data
Right 1144599203 17:16598145-16598167 CTGGCCAAACTGATCTACCTTGG No data
1144599198_1144599203 1 Left 1144599198 17:16598121-16598143 CCCCGTAGCTCCAACACAGAAAG No data
Right 1144599203 17:16598145-16598167 CTGGCCAAACTGATCTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144599203 Original CRISPR CTGGCCAAACTGATCTACCT TGG Intergenic
No off target data available for this crispr