ID: 1144600378

View in Genome Browser
Species Human (GRCh38)
Location 17:16607622-16607644
Sequence TGGGAGTCCCAGGACAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144600378_1144600388 12 Left 1144600378 17:16607622-16607644 CCTGGATTGTCCTGGGACTCCCA No data
Right 1144600388 17:16607657-16607679 TTGGAGCATCAGGATTTTCCTGG No data
1144600378_1144600383 -7 Left 1144600378 17:16607622-16607644 CCTGGATTGTCCTGGGACTCCCA No data
Right 1144600383 17:16607638-16607660 ACTCCCACAGCCTGGGGAATTGG No data
1144600378_1144600389 23 Left 1144600378 17:16607622-16607644 CCTGGATTGTCCTGGGACTCCCA No data
Right 1144600389 17:16607668-16607690 GGATTTTCCTGGCGATAATATGG No data
1144600378_1144600386 2 Left 1144600378 17:16607622-16607644 CCTGGATTGTCCTGGGACTCCCA No data
Right 1144600386 17:16607647-16607669 GCCTGGGGAATTGGAGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144600378 Original CRISPR TGGGAGTCCCAGGACAATCC AGG (reversed) Intergenic
No off target data available for this crispr