ID: 1144603925

View in Genome Browser
Species Human (GRCh38)
Location 17:16646802-16646824
Sequence GTCTTAACAAGCCTGTCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144603925_1144603928 3 Left 1144603925 17:16646802-16646824 CCCTTAGACAGGCTTGTTAAGAC 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1144603928 17:16646828-16646850 GGTCTAATATGACTCTGAAATGG 0: 1
1: 0
2: 0
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144603925 Original CRISPR GTCTTAACAAGCCTGTCTAA GGG (reversed) Intronic