ID: 1144610370

View in Genome Browser
Species Human (GRCh38)
Location 17:16706876-16706898
Sequence CCCCAGGTAAACAGGTATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 3, 1: 0, 2: 1, 3: 6, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144610370_1144610375 -7 Left 1144610370 17:16706876-16706898 CCTAGATACCTGTTTACCTGGGG 0: 3
1: 0
2: 1
3: 6
4: 105
Right 1144610375 17:16706892-16706914 CCTGGGGAAAGATGAGGATGAGG 0: 4
1: 0
2: 5
3: 81
4: 659
1144610370_1144610376 -6 Left 1144610370 17:16706876-16706898 CCTAGATACCTGTTTACCTGGGG 0: 3
1: 0
2: 1
3: 6
4: 105
Right 1144610376 17:16706893-16706915 CTGGGGAAAGATGAGGATGAGGG 0: 4
1: 0
2: 5
3: 54
4: 651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144610370 Original CRISPR CCCCAGGTAAACAGGTATCT AGG (reversed) Intronic
903169078 1:21541073-21541095 ATCCAGGTGAACAGGTCTCTGGG + Intronic
905827576 1:41037597-41037619 CTCCACTCAAACAGGTATCTGGG - Intronic
905835756 1:41119313-41119335 CCCAAGGTAAAGAGATTTCTTGG + Intronic
906248871 1:44296080-44296102 CCCCAGGGATAAAGGAATCTAGG - Intronic
906465078 1:46071365-46071387 CGCAAGGTAAAAATGTATCTAGG - Intronic
908760265 1:67505314-67505336 CCCCAGCTACACATGTAGCTGGG - Intergenic
909789873 1:79662551-79662573 TGCCAGGTAAACAGATACCTAGG - Intergenic
912563246 1:110565435-110565457 CCCCAGCTAAATACGTAGCTTGG + Intergenic
915018448 1:152758392-152758414 CCCCAGGGAAATAGATATGTAGG + Intronic
917474449 1:175356281-175356303 CCCCAGGGATACGGGTATGTAGG + Intronic
918210219 1:182343792-182343814 CTCCAGGTGAACAGGAGTCTTGG - Intergenic
919058152 1:192596594-192596616 ACCCAGCCAAACAGGAATCTAGG + Intergenic
920015974 1:202908993-202909015 GCCTAGGTAAGCTGGTATCTCGG - Exonic
1063580018 10:7297848-7297870 CCTCAGGTATACAGGTGTCGAGG - Intronic
1064172550 10:13046994-13047016 CCCAGGGTGAACAGATATCTGGG - Intronic
1073984150 10:109189062-109189084 CCCCAGGGGTACAGGTTTCTGGG - Intergenic
1082837364 11:57661160-57661182 CCAAAGGTAAACAGGAGTCTGGG - Exonic
1083695331 11:64438737-64438759 CCCCAGGGACTCTGGTATCTGGG + Intergenic
1084615400 11:70232352-70232374 CCCCAGGTAGAAAGGGATCTGGG - Intergenic
1086741441 11:90374466-90374488 ACACAGGTAAACATGTATCATGG + Intergenic
1090951357 11:131476355-131476377 CCCCAGCTAATCATGTACCTGGG + Intronic
1091269962 11:134301132-134301154 CCCCAGGTAAGCAAGTGGCTTGG + Intronic
1101000795 12:100355790-100355812 CCCCAGTTCAACAAGTATTTAGG + Intergenic
1102694328 12:114786312-114786334 CCCCAAGTCTACAGGCATCTGGG + Intergenic
1104004549 12:124882860-124882882 CCCCAGCTACTCAGGTAACTGGG + Intergenic
1104600601 12:130150827-130150849 CCCCAGGTAGCCAGGCACCTTGG + Intergenic
1111946977 13:94676438-94676460 CCACCGGGAAACAGGAATCTGGG - Intergenic
1119896424 14:78223682-78223704 CCTCAGGGAAAGAGTTATCTTGG - Intergenic
1128652265 15:69426603-69426625 CCTCAGGTACACAAGTAGCTGGG - Intronic
1129895188 15:79100002-79100024 CTCCAGGAAAACAATTATCTTGG - Intergenic
1130540884 15:84820037-84820059 CCCCAGGTCACCCGGCATCTAGG + Intronic
1130567864 15:85013003-85013025 CCACAGTTAAACAGAAATCTGGG + Intronic
1132219323 15:100093525-100093547 CCCCAGGTCAAGAGGCATCTTGG - Intronic
1134467658 16:14493640-14493662 CACCAAGTAGGCAGGTATCTAGG + Intronic
1135307666 16:21380823-21380845 CCCCAGGTCACCAGGTAGCAAGG - Intergenic
1135436119 16:22427825-22427847 CCCAAGGAAAACAGGAATGTTGG + Intronic
1136304410 16:29359943-29359965 CCCCAGGTCACCAGGTAGCAAGG - Intergenic
1140220155 16:73037932-73037954 CCCCAGGCATACGGTTATCTGGG + Intronic
1140760823 16:78107258-78107280 CACCAGGTAATAAGGTATCCAGG - Intronic
1141801750 16:86314525-86314547 CCCCAGATAAAGAGGGATCAAGG - Intergenic
1142045330 16:87921656-87921678 CCCAAGGAAAACAGGAATGTTGG + Intronic
1144610370 17:16706876-16706898 CCCCAGGTAAACAGGTATCTAGG - Intronic
1144902374 17:18608540-18608562 CCCAGGGTAAACAGGTATCTAGG + Intergenic
1144928690 17:18837439-18837461 CCCCAGGTAAACAGGTATCTAGG - Intergenic
1145130126 17:20337564-20337586 CCCCAGGTAAACAGGTATCTAGG - Intergenic
1145392375 17:22465595-22465617 CTCCATGTATTCAGGTATCTGGG - Intergenic
1147780103 17:42934918-42934940 CATCAGGCAAACAGGTATCTGGG - Intergenic
1151380677 17:73723807-73723829 TCCCAGGCAAACAGGAATATAGG + Intergenic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
925867729 2:8243858-8243880 CCACAGGTAAGCAGGGATCCAGG + Intergenic
926460808 2:13127381-13127403 CCCCAGGTACAGAGACATCTGGG + Intergenic
935005470 2:99071762-99071784 CGCCAGGGAAAGAGATATCTTGG - Exonic
935272449 2:101446730-101446752 CTCCAGGAAAACAAGTAACTAGG - Intronic
938825917 2:135005200-135005222 CCATAGGTAAACATGTATCATGG + Intronic
940658642 2:156519778-156519800 ACCCAGGCAAACAGGTGCCTGGG + Intronic
942306765 2:174616185-174616207 GCCAAGGTAAACTGGTCTCTTGG - Intronic
944492708 2:200274198-200274220 CCCCATAAAAACAGCTATCTTGG + Intergenic
1169257744 20:4111578-4111600 CCCCCGGTGACCAGGTAACTAGG + Intergenic
1170994525 20:21339211-21339233 CTACAGGTAAAAAGGTAACTGGG - Intronic
1173426179 20:42945581-42945603 CCTCAGGGAAACAGGCACCTTGG - Intronic
1173522273 20:43709131-43709153 CCCCAGGTAGCCAGGGACCTGGG - Intronic
1174333271 20:49838153-49838175 CCCAAGGTAACCAACTATCTTGG - Intronic
1175981825 20:62742601-62742623 CCCTGTGTAAACAGGTGTCTGGG - Intronic
1176950114 21:15034478-15034500 CCCCAGGAAAACAGTTTTCAGGG - Intronic
1181537587 22:23554517-23554539 CCCCAGGTGGACAGGTCTGTGGG - Intergenic
1182760171 22:32716324-32716346 CCCCAGGCAACTAGGTATGTGGG + Intronic
1184550584 22:45202389-45202411 CCCCAGGTCACAAGGTCTCTTGG - Intronic
953844579 3:46417304-46417326 TCCCAGTTAAGCAGGCATCTGGG + Intergenic
954925959 3:54234955-54234977 ACACAGGTAAACATGTGTCTTGG - Intronic
956330087 3:68096962-68096984 CAGCAGGTAAAATGGTATCTGGG + Intronic
957010472 3:74999609-74999631 CCCAAGGGAAACAGGTACCCAGG - Intergenic
958935571 3:100252125-100252147 CCCCAGGTAAATAACTCTCTGGG - Intergenic
962124083 3:132596369-132596391 ACACAGGTAAACATGTATCATGG - Intronic
962438656 3:135391540-135391562 CCCCAGGTTCACAGGTTGCTGGG + Intergenic
968320395 3:197762949-197762971 ACACAGGTAAACATGTATCACGG - Intronic
971106500 4:23530464-23530486 GCACAGGTAAACATGTATCACGG - Intergenic
976176655 4:82360835-82360857 CCTCAGTTAATCAGGTATCTTGG - Intronic
977300840 4:95265600-95265622 CCCCAGGCAAATATGTATTTGGG - Intronic
980286534 4:130785257-130785279 CTCCAGTTAAACAGGTAGCAAGG - Intergenic
984274145 4:177588500-177588522 GCACAGGTAAACACGTGTCTTGG + Intergenic
987881962 5:23759661-23759683 CTCCAGATAAACAGCTATGTCGG + Intergenic
988792896 5:34624811-34624833 CCTCAGGTAAACAGGTAATTAGG + Intergenic
993282321 5:85940474-85940496 ACCCAGGTAAACAGGTAAACTGG + Intergenic
997667615 5:135644443-135644465 CCCCAGGTGCACATGTCTCTAGG + Intergenic
1010723339 6:79308482-79308504 TCCCAGTTATACAGGCATCTGGG + Intergenic
1011851586 6:91636007-91636029 TCCTAGGTAAACAGGAAGCTTGG + Intergenic
1012172040 6:96029053-96029075 CACCAGGCAAACAAATATCTAGG + Intronic
1013018194 6:106180468-106180490 CTCAAAGTAAACAGGTCTCTCGG + Intergenic
1015013268 6:128376989-128377011 GCCCAAGTCAACAGGTCTCTAGG + Intronic
1016249658 6:142025687-142025709 ACCCAGGAATACAGGTAACTAGG + Intergenic
1016610495 6:145983690-145983712 TTCCAGGTAAACAGGGATCTAGG + Intergenic
1019314976 7:380118-380140 CCCCAGGTCAGCAGGACTCTGGG + Intergenic
1020149693 7:5672282-5672304 CCCAAAGTAAACATGTATTTAGG - Intronic
1021187814 7:17585832-17585854 CACCTGGTAAACAGCTTTCTTGG - Intergenic
1022956333 7:35385046-35385068 CCCAAGATAAACTGGAATCTGGG + Intergenic
1023418035 7:39950418-39950440 CCCCAGGGAAGCAGGAATCCGGG - Exonic
1026224667 7:68429748-68429770 CCCCAGGATAACAGGTTCCTGGG + Intergenic
1029110596 7:98211493-98211515 CCCCAGGTAACCCGGGAGCTGGG + Exonic
1030079753 7:105767246-105767268 CCCCAGGAAAGCTGGAATCTTGG - Intronic
1031240012 7:119225834-119225856 ACACAGGTAAACATGTGTCTAGG + Intergenic
1032087709 7:128892505-128892527 CCCCAGGTGCCCAGGTATGTGGG - Exonic
1032755557 7:134887359-134887381 CCCAAGGTGAACAGGAATGTAGG - Intronic
1035703752 8:1658182-1658204 AGCCAGGTATACAGGTATCATGG - Intronic
1036928547 8:12930956-12930978 CCCCAGCTACACAGGAATCCAGG + Intergenic
1039354127 8:36795950-36795972 CACCATGGAAACAGCTATCTGGG + Intronic
1044394043 8:91688408-91688430 CCCCAGGCATACAGGTCTCCAGG + Intergenic
1047379375 8:124344108-124344130 CCACAGATAAAAATGTATCTTGG - Intronic
1049509232 8:143019218-143019240 CCCCTGGGAGCCAGGTATCTAGG - Intronic
1049826382 8:144671514-144671536 GCCCAGGTGAGCAGGCATCTGGG - Intergenic
1057820382 9:98325696-98325718 CCCCAGGTGAACAGGGTGCTAGG - Intronic
1059529745 9:115024969-115024991 CATCAGTTAAAAAGGTATCTGGG - Intronic
1060424627 9:123494003-123494025 TCCCAGGAAAACAGGGGTCTGGG + Intronic
1191123473 X:56929789-56929811 CATCAGGTAAACACGTACCTTGG + Intergenic
1195755483 X:108195073-108195095 CTCCAGGGCAACAGGTATTTTGG - Exonic
1199854838 X:151751817-151751839 CCCCAGTTGAACAGGGAGCTGGG + Intergenic