ID: 1144611038

View in Genome Browser
Species Human (GRCh38)
Location 17:16715858-16715880
Sequence CTCGCTCCAATCCACAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 3, 1: 1, 2: 0, 3: 5, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144611038_1144611040 13 Left 1144611038 17:16715858-16715880 CCAGGCTTGTGGATTGGAGCGAG 0: 3
1: 1
2: 0
3: 5
4: 86
Right 1144611040 17:16715894-16715916 GGCTGTCTTTCCAAAGCAAGTGG 0: 2
1: 2
2: 0
3: 20
4: 187
1144611038_1144611042 29 Left 1144611038 17:16715858-16715880 CCAGGCTTGTGGATTGGAGCGAG 0: 3
1: 1
2: 0
3: 5
4: 86
Right 1144611042 17:16715910-16715932 CAAGTGGCGCACGTTGATATTGG 0: 1
1: 0
2: 2
3: 2
4: 22
1144611038_1144611039 -8 Left 1144611038 17:16715858-16715880 CCAGGCTTGTGGATTGGAGCGAG 0: 3
1: 1
2: 0
3: 5
4: 86
Right 1144611039 17:16715873-16715895 GGAGCGAGTTTGTGTTTAATTGG 0: 3
1: 1
2: 1
3: 28
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144611038 Original CRISPR CTCGCTCCAATCCACAAGCC TGG (reversed) Intronic
900250754 1:1667880-1667902 CTCGCTCCCATCCCCCAGGCTGG + Intronic
900261724 1:1734243-1734265 CTCGCTCCCATCCCCCAGGCTGG + Intronic
902878008 1:19352632-19352654 CTCACACACATCCACAAGCCTGG + Intronic
904013885 1:27405941-27405963 CTCAGTCCATTCCAGAAGCCAGG + Exonic
904305372 1:29585462-29585484 CTCTCTCCCACCCACAAGCTGGG - Intergenic
906448230 1:45922124-45922146 CTCCCTCCTCTCCCCAAGCCTGG + Intronic
908537822 1:65094667-65094689 AACGCTCCAATCCATAAGCATGG + Intergenic
909364691 1:74805378-74805400 ATAGCACCAATCCACAAGCCAGG - Intergenic
910849680 1:91637925-91637947 CTCACCCCAATCCCCAGGCCTGG - Intergenic
913465311 1:119135292-119135314 CCCGCCCCACTCCACAACCCAGG - Intronic
919858221 1:201720060-201720082 CACGCTCAGATCCACCAGCCTGG + Intronic
1063111743 10:3044158-3044180 CTCACTCCAATCCAAAAGGCTGG - Intergenic
1063335018 10:5203747-5203769 CTGCCTCCAATCCACAATCTTGG + Intronic
1063377775 10:5564262-5564284 ATCTCTCCAAACCACAAGTCAGG + Intergenic
1065517233 10:26536620-26536642 CTCACTCTAATCCACAGGCTGGG + Intronic
1066394544 10:35006253-35006275 CTGGCCCCTATCCACAACCCAGG - Intergenic
1066444167 10:35466501-35466523 CTCTCTCCAATTCACAACACTGG - Intronic
1070690486 10:78521390-78521412 CTCTCTTCATTCCACAAGGCAGG - Intergenic
1077375832 11:2204747-2204769 TTCGCTCCTCTCCACAACCCTGG + Intergenic
1077964762 11:7117796-7117818 TTCCCTTCAACCCACAAGCCTGG + Intergenic
1078767509 11:14312909-14312931 TTCCCTCCAAACCACATGCCTGG + Intronic
1079536236 11:21518673-21518695 CTCCCACCAAACTACAAGCCTGG - Intronic
1083478806 11:62930452-62930474 CTGCCTCCAACCCCCAAGCCTGG + Intergenic
1084296310 11:68214850-68214872 CACGCTCCAATTCACACTCCAGG - Intergenic
1085532800 11:77201858-77201880 CTCTCTCCAATCCCCACCCCCGG - Intronic
1086558677 11:88141928-88141950 CTCTCTCCAACCAACATGCCTGG + Intronic
1089851408 11:121499945-121499967 CCAGCTCCAGTCCAGAAGCCAGG - Intronic
1091450221 12:568279-568301 CCAGCTCTAATCCACATGCCTGG + Intronic
1091550032 12:1530235-1530257 CTCGCTCCTGCCCACCAGCCGGG - Intronic
1096466971 12:51851947-51851969 CGCACCCCAATCCCCAAGCCAGG - Intergenic
1096869195 12:54582911-54582933 CAGGCTCCAATCCAAAAGCCTGG - Intronic
1097821487 12:64132946-64132968 GTGGCTCCAATCCACATACCAGG + Intronic
1102786774 12:115611504-115611526 CTCGCTTCGCTCCAGAAGCCTGG - Intergenic
1103951606 12:124554476-124554498 CTCTCTCCAAGGCAAAAGCCAGG + Intronic
1108605063 13:52029431-52029453 CTCTCTCCAAGCCATGAGCCTGG + Exonic
1122042247 14:98997109-98997131 TTCCCTCCAATCCACATGGCTGG + Intergenic
1124436282 15:29651975-29651997 CCCCCTCCAATCCACAGGACTGG - Intergenic
1125198062 15:37071367-37071389 CTGGCCCCAAGCCCCAAGCCCGG - Intronic
1128799107 15:70486385-70486407 CTCTCTCCACTTCACAGGCCAGG - Intergenic
1133120130 16:3601229-3601251 TTTGCTCCAATCCACATTCCTGG - Intronic
1134022152 16:10928722-10928744 CCTGCCCCACTCCACAAGCCAGG - Exonic
1136913103 16:34159929-34159951 CTCCCTCCCTCCCACAAGCCGGG + Intergenic
1139548327 16:67660134-67660156 CACCCTCCAGTCCACGAGCCGGG - Exonic
1142261024 16:89042506-89042528 CCCGCGCCCATCCACACGCCTGG - Intergenic
1143769758 17:9161181-9161203 CCCGCTCCACCCCACCAGCCTGG - Intronic
1144611038 17:16715858-16715880 CTCGCTCCAATCCACAAGCCTGG - Intronic
1144901699 17:18599505-18599527 CTCGCTCCAATCCACAAGCCTGG + Intergenic
1144929373 17:18846555-18846577 CTCGCTCCAATCCACAAGCCTGG - Intronic
1145130805 17:20346562-20346584 CTCACTCCAATCCACAAGCCTGG - Intergenic
1152457309 17:80423749-80423771 CTTACTCCAGGCCACAAGCCAGG - Intronic
1157210217 18:45735759-45735781 CACGCTCCCTTCCACAATCCAGG + Intronic
1161460836 19:4396513-4396535 CTCGCTCTCATCCACCAGGCTGG + Intronic
1162833785 19:13303205-13303227 CCCTCTCCCATCCACTAGCCTGG + Intronic
1163838897 19:19593646-19593668 CTCCCTGAAATGCACAAGCCTGG - Intronic
1167464102 19:49641069-49641091 CTCGCTCGGATCCAGAATCCTGG - Intergenic
928124539 2:28606587-28606609 CTGGCTCCTCTCCACAAACCAGG + Intronic
931906732 2:66850661-66850683 CTCCCTCCCATCCCCCAGCCTGG - Intergenic
940889875 2:159024932-159024954 CTTACACAAATCCACAAGCCTGG - Intronic
946179785 2:217942440-217942462 CTCACTCCCTTCCACAACCCTGG + Intronic
946199671 2:218064483-218064505 CTCGCTCCATCCCACAACCCTGG + Intronic
947573155 2:231251055-231251077 TTCTCTCCAATCCCCATGCCAGG - Intronic
1171019751 20:21574583-21574605 CCCACTCCTGTCCACAAGCCGGG + Intergenic
1174415446 20:50363393-50363415 CTCCCACCAATCCCTAAGCCTGG + Intergenic
1178507326 21:33172665-33172687 TTATCTCCCATCCACAAGCCAGG + Intergenic
1182003900 22:26943324-26943346 CTCCCTACAATCCATAAGCTGGG - Intergenic
1185262209 22:49873841-49873863 CTCGCTCCAACCTACAAGGTGGG - Intronic
949745156 3:7282400-7282422 CTCTCGCCTATCCACAAACCTGG + Intronic
951307954 3:21088802-21088824 ATTCTTCCAATCCACAAGCCTGG - Intergenic
953295408 3:41710746-41710768 ATCGCTCCGCTGCACAAGCCTGG + Intronic
965840915 3:172904785-172904807 CTCTCTCCATTCCACAGGCGAGG + Intronic
968299722 3:197603335-197603357 CGCGCTTCCATCCACAAGCAAGG - Intergenic
968922865 4:3531744-3531766 CTCGCTCAAATGAACAAGCACGG + Intronic
976220324 4:82752023-82752045 CTTGCTAAAATCCACAATCCAGG - Intronic
977880672 4:102201264-102201286 CTCGCCCCATTCCACAAGTAAGG + Intergenic
996137854 5:119867315-119867337 CTGTCTCCAACCCAGAAGCCAGG - Intergenic
998541154 5:142982744-142982766 CTAGCTCCAAATCACAAGCTTGG + Intronic
1001568386 5:172714926-172714948 CTCCCTCCAATCCCCACTCCTGG + Intergenic
1005152992 6:22774139-22774161 CACGCTCAAATGCACAAGTCTGG - Intergenic
1010372184 6:75123334-75123356 CTCCCACCATTCCACCAGCCCGG - Exonic
1010519706 6:76818009-76818031 CTCACTCCAGTCCACAAAACTGG - Intergenic
1017993386 6:159509776-159509798 CTCGCTCCAACTCAAAAGCAAGG - Intergenic
1025255108 7:57379369-57379391 CTCCCACCAATCCCTAAGCCTGG - Intergenic
1026832348 7:73617992-73618014 CTCGTCTCCATCCACAAGCCAGG + Intronic
1028732932 7:94173745-94173767 CTCTCTCCAATGCAGAAGTCAGG - Intergenic
1033380733 7:140815477-140815499 GTCGCACCATTGCACAAGCCTGG - Intronic
1036766096 8:11550205-11550227 CTTGCTCCAATCAACAAGGCCGG + Exonic
1037526612 8:19730695-19730717 TTCGCTCCTATCCAGGAGCCAGG - Intronic
1038018616 8:23534781-23534803 CTCGCTGCACTTCACATGCCTGG + Intronic
1045345885 8:101292967-101292989 CTGGCTCCAAACTGCAAGCCAGG + Intergenic
1055044221 9:71908433-71908455 CTCTCTCCAACTCACAAGGCTGG + Intronic
1056560919 9:87728344-87728366 CTCTCTCCAATCCACAGATCTGG - Exonic
1060433815 9:123575397-123575419 CTGGCACCAATCCACAGCCCAGG + Intronic
1190137046 X:47807002-47807024 CTCAGTCCATTCCAGAAGCCAGG - Intergenic
1195861158 X:109384847-109384869 CTCCCACAAACCCACAAGCCCGG + Intronic
1198708553 X:139476506-139476528 CTGGTTGCAATCCTCAAGCCTGG + Intergenic