ID: 1144611042

View in Genome Browser
Species Human (GRCh38)
Location 17:16715910-16715932
Sequence CAAGTGGCGCACGTTGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 22}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144611038_1144611042 29 Left 1144611038 17:16715858-16715880 CCAGGCTTGTGGATTGGAGCGAG 0: 3
1: 1
2: 0
3: 5
4: 86
Right 1144611042 17:16715910-16715932 CAAGTGGCGCACGTTGATATTGG 0: 1
1: 0
2: 2
3: 2
4: 22
1144611037_1144611042 30 Left 1144611037 17:16715857-16715879 CCCAGGCTTGTGGATTGGAGCGA 0: 3
1: 1
2: 1
3: 11
4: 115
Right 1144611042 17:16715910-16715932 CAAGTGGCGCACGTTGATATTGG 0: 1
1: 0
2: 2
3: 2
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144611042 Original CRISPR CAAGTGGCGCACGTTGATAT TGG Intronic
1064789929 10:18946007-18946029 CTAGTGGGGGATGTTGATATTGG - Intergenic
1076050716 10:127331093-127331115 CAAGTGGCTAAAGGTGATATAGG + Intronic
1094091060 12:26650497-26650519 CTAGTGGAGGATGTTGATATGGG + Intronic
1101237195 12:102801851-102801873 CAAGTGGAGCAATTAGATATGGG - Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1144611042 17:16715910-16715932 CAAGTGGCGCACGTTGATATTGG + Intronic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1145130809 17:20346614-20346636 CAAGTGGTCCACATTGATATTGG + Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
943843083 2:192604373-192604395 CAAGTAGTGCCCATTGATATAGG + Intergenic
1168995557 20:2130223-2130245 TAAGTGGCGCCCGTTTATCTGGG + Intronic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
952893266 3:38058779-38058801 CTAGTGGGGGACGTTGATAATGG + Intronic
959497128 3:107064645-107064667 CTAGTGGTGCACGGTGATATAGG + Intergenic
971708616 4:30081772-30081794 CACTTGGCACACTTTGATATTGG - Intergenic
976442561 4:85092263-85092285 CATGTTGCCCACGTTGATCTTGG + Intergenic
978744479 4:112176096-112176118 CAATTTGTGCACGTTAATATTGG - Intronic
991947789 5:71916448-71916470 CAAGTGGTCCACATTGGTATTGG - Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic