ID: 1144614319

View in Genome Browser
Species Human (GRCh38)
Location 17:16754737-16754759
Sequence GTCCATGTGGTCTATAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 3, 1: 4, 2: 16, 3: 32, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144614319 Original CRISPR GTCCATGTGGTCTATAGTGC AGG Intronic
901921236 1:12539330-12539352 CTCCATGTGGTCTGTCCTGCAGG - Intergenic
902120010 1:14156348-14156370 GCCCATTTGGTCTATAGTGGAGG + Intergenic
904431679 1:30468498-30468520 GTCCATGCAGTCTATGTTGCAGG - Intergenic
905987391 1:42299133-42299155 GTCCATCTGGTCTACAGTTTAGG + Intronic
907443030 1:54490132-54490154 GTCCCTATGGTCTAGAGGGCTGG - Intergenic
910801048 1:91146566-91146588 GTCCATTCGGTCTACAGTGCAGG + Intergenic
911981283 1:104569799-104569821 GCCTATTTGGTCTATACTGCAGG - Intergenic
912443671 1:109717215-109717237 TTCCATGTGGGCTCAAGTGCTGG - Intronic
913092476 1:115487527-115487549 GTCCATGGGCTCCATAGTGATGG - Intergenic
913173797 1:116255864-116255886 GTCCAAAGGGTCTACAGTGCTGG + Intergenic
916616127 1:166442291-166442313 GTCCATCTGGTCTATAGCGCAGG + Intergenic
1064159675 10:12933785-12933807 GTCCATGGGATCTGTAGTGATGG + Intronic
1066138613 10:32479121-32479143 GTCCATGTGGTCGGTAGGGATGG + Intronic
1067547377 10:47203544-47203566 GTCCATGTGGTATGGAGTGGAGG + Intergenic
1070059007 10:72964244-72964266 GTCCATTTGTTTTGTAGTGCAGG + Intergenic
1070627766 10:78063378-78063400 GTTCCTGGGGTCTAAAGTGCAGG + Intergenic
1074491149 10:113940800-113940822 CTCCATGTGCTCTTTACTGCAGG + Intergenic
1075830274 10:125404302-125404324 GTCCATTTGGTCTATAGCACAGG + Intergenic
1078002609 11:7509958-7509980 CTCTATGTGGTCTACAGTACTGG + Exonic
1082948253 11:58783340-58783362 GTCCACTTGGTCTATATTGCAGG - Intergenic
1083109855 11:60395128-60395150 GCCCATGTGGTACAAAGTGCAGG - Intronic
1084616955 11:70242849-70242871 GTACATGTGCTCCATAGAGCAGG + Intergenic
1085178810 11:74514704-74514726 GTCCATTTGGTCTATAGTGCAGG - Intronic
1086249107 11:84793412-84793434 GTCCATTTGTCCTAAAGTGCAGG + Intronic
1086569880 11:88269837-88269859 GTCCATTTGTTCTATAGTGTAGG - Intergenic
1087492135 11:98841926-98841948 GTCCATTTGGTCTATAGTGTAGG + Intergenic
1087992135 11:104758192-104758214 GACCATGTGTGCTAGAGTGCTGG - Intergenic
1090683174 11:129083980-129084002 GTCCATGTGATCTGTAGTGACGG - Intronic
1094758463 12:33499344-33499366 GTCTATTTGGTCTGTAGTGCAGG - Intergenic
1095909622 12:47413104-47413126 GACCGTGTGGTCTATAGTGTAGG - Intergenic
1098207593 12:68129361-68129383 ACCCATTTGGTCTATAGTGCAGG + Intergenic
1098967778 12:76810995-76811017 GTCCATGTGGTCTTTCCAGCAGG + Intronic
1103195641 12:119041541-119041563 GTCCATGGGATCCATATTGCAGG - Intronic
1110078713 13:71284075-71284097 GTTCATTTGGTTTATGGTGCAGG + Intergenic
1110917240 13:81036726-81036748 ATCCATTTGGCCTATAGTGCAGG - Intergenic
1112944365 13:104908775-104908797 GTCCATTTGTTCTTTAGTGCAGG + Intergenic
1115381283 14:32742880-32742902 ATCCATTTGGTCTATAGTGCAGG + Intronic
1116402555 14:44526386-44526408 GTCCATTTGGCCCATACTGCTGG - Intergenic
1118962327 14:70545843-70545865 GTCCATTTGATCCATACTGCAGG - Intergenic
1123991462 15:25686799-25686821 GGCCATGTGGTCCATCCTGCAGG + Intronic
1125078169 15:35645089-35645111 GTCCATTTGGTCAAGAGTTCAGG - Intergenic
1127196699 15:56593875-56593897 GTCCATTTGGTCTAAAGTGCAGG - Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1129375358 15:75126822-75126844 GTACATGTGCTTTATGGTGCAGG + Intergenic
1135989430 16:27208723-27208745 GCCCATGTGGTGTCTTGTGCTGG + Intronic
1138460812 16:57146636-57146658 ATCCATGTGGTGTAAAGTGCAGG + Intronic
1141043768 16:80695879-80695901 GTTCATTTGGTCTGTAGTGGAGG - Intronic
1144614319 17:16754737-16754759 GTCCATGTGGTCTATAGTGCAGG + Intronic
1144898388 17:18560940-18560962 GTCCATGTGGTCTATAGTGCAGG - Intergenic
1145133987 17:20384781-20384803 GTCCATGTGGTCTATAGTGCAGG + Intergenic
1146413082 17:32605695-32605717 GTCTGTGTGGTCTATAGAGATGG - Intronic
1154386855 18:13900876-13900898 GTTCATTTGGTATATACTGCAGG - Intronic
1156215377 18:34992881-34992903 GTGCATGTGGTTTTTAGTGTTGG + Intronic
1157886645 18:51373771-51373793 GTCAATTTGGTCTACAGTACAGG - Intergenic
1159023453 18:63161939-63161961 GTCCATGTGACCTGCAGTGCTGG + Intronic
1160434965 18:78843674-78843696 GTCCATTTGGTTTATTGTGTTGG + Intergenic
1160533159 18:79577164-79577186 GGCCATGTGGCCTGTGGTGCTGG - Intergenic
1166651897 19:44581221-44581243 GTCCATGTGGGAGATGGTGCTGG - Intergenic
930141840 2:47958941-47958963 GTCCTTTTGGTCTGTAGTGCAGG - Intergenic
930527458 2:52547839-52547861 GTCCATTTGGTCTATAGTGCAGG + Intergenic
931201999 2:60106449-60106471 GTCCATGTGGTTTATATTCAGGG - Intergenic
932946343 2:76236583-76236605 GTCCATTTGGTCTAGAGTGCAGG + Intergenic
936939549 2:117870358-117870380 GTCCATTAGGTCTATAGCACAGG + Intergenic
946676924 2:222170174-222170196 ATCTATGTGGTGTATGGTGCTGG - Intergenic
1170236331 20:14108894-14108916 GTCCATTTGGTCTATAGTGCGGG - Intronic
1173218503 20:41111141-41111163 GTCCATGTGCACTAGAGTGAGGG + Intronic
1173342742 20:42167560-42167582 CTCCATGTGCTCTTTAGGGCAGG + Intronic
1174939113 20:54904563-54904585 GTCCATTTGGTCTATAGTGCAGG - Intergenic
1176670173 21:9726683-9726705 GTTCAAGTGTTCTATAGTGAAGG - Intergenic
1181717671 22:24744867-24744889 GTCCCTCTGGTGTATAGTGCAGG - Intronic
1182384573 22:29926138-29926160 GTACATGTGGCCTTTTGTGCTGG + Intronic
952996115 3:38884023-38884045 GGCAATGTGGTCTATATTGAAGG - Intronic
954471827 3:50704284-50704306 GTCCATTTGTTCTATAGTGCAGG + Intronic
956483507 3:69696821-69696843 GTCCATGTGGTCTCTACAGTGGG - Intergenic
957622172 3:82607629-82607651 ATCCATTTGGTCTACAGTGCAGG - Intergenic
958051954 3:88359876-88359898 ATCCAACTGGTCTATAGTGCAGG + Intergenic
958067924 3:88568628-88568650 TTCCGTTTGGTCTATAGTGCAGG - Intergenic
958083552 3:88777454-88777476 CTACATTTGGTCTATAGTGCAGG - Intergenic
959080897 3:101799887-101799909 GTCCATGGGATCTGTAGTGATGG + Intronic
959818757 3:110706746-110706768 GTCCATTTGTTCTATAGTGTAGG + Intergenic
960251276 3:115457347-115457369 GTCCATGGGATCAATAGTGATGG + Intergenic
961423728 3:126828634-126828656 GTCCATGTGATCTTTGGTGAAGG + Intronic
962870668 3:139489072-139489094 GTCCATTTGGTGTATAGTGCAGG + Intergenic
967365059 3:188676973-188676995 GTCCATGTGGTAAAGAGTGAGGG + Intronic
967544483 3:190708301-190708323 GTTAATGTGATCTATTGTGCTGG - Intergenic
973327138 4:48874571-48874593 GTCCATTTGTTCCATAGTGCAGG + Intergenic
973902474 4:55490821-55490843 GTCCATTTGGTCTATACAGTTGG - Intronic
978097804 4:104800451-104800473 GTCAATTTGGTCTATAGTACAGG - Intergenic
978212373 4:106153577-106153599 GTCCATTTGGTCTATAATGCAGG + Intronic
984071028 4:175112487-175112509 GTCCATTTGGTCTGTACTTCAGG - Intergenic
984172934 4:176382652-176382674 GTCCATGTTGGCAATAGTGGGGG + Intergenic
985404609 4:189624855-189624877 GTTCAAGTGTTCTATAGTGAAGG + Intergenic
988608036 5:32698487-32698509 GTCCATTTGGTCTATAATGCAGG + Intronic
989487681 5:42011075-42011097 GTCCATGTGTTCTATCCTGATGG + Intergenic
990265052 5:54066196-54066218 TTCCATGTGGTCTCTAGTATAGG - Intronic
996906195 5:128603568-128603590 TTCCATTTGGTCTATAGTGCAGG + Intronic
998725589 5:145009699-145009721 GTCCATAATGGCTATAGTGCGGG + Intergenic
998820791 5:146056012-146056034 GTCCATGTGGTGTAGAGACCAGG - Exonic
1000645046 5:163751018-163751040 GGACATGTAGTATATAGTGCAGG - Intergenic
1008641757 6:53470838-53470860 GTTCATTTGGTCTGTAGCGCAGG + Intergenic
1008847907 6:55990764-55990786 GTCCATTTGGGCTATAGTGCAGG + Intergenic
1011520751 6:88202446-88202468 GTCCATTTCACCTATAGTGCAGG - Intergenic
1014108857 6:117597962-117597984 ATCCATGTGGTCTTCAATGCAGG - Intronic
1016875967 6:148865081-148865103 GTTCATTTGGTCTGTACTGCAGG + Intronic
1017101357 6:150852339-150852361 TTCCATGTGGTATTTAATGCGGG - Intergenic
1017998138 6:159552587-159552609 GTCCATTTGGTCTATGGTGCAGG + Intergenic
1019866220 7:3712865-3712887 GTCCAAGGGGTCTATATTGTGGG - Intronic
1020515284 7:9110013-9110035 ATCCATTTGGTCTATAGTGCAGG - Intergenic
1024240411 7:47430560-47430582 GTCTATTTGGTCTAAAGTGCAGG - Intronic
1027727165 7:81821992-81822014 TTCCATATGGTCTATTGTGATGG + Intergenic
1033985246 7:147217965-147217987 GTCCATGAGATCTATAGTAATGG + Intronic
1035942770 8:3921895-3921917 GTCCATCTGGTCCATACTGTTGG + Intronic
1037951901 8:23024047-23024069 GTCCAGATGGTCTATAGCACAGG + Intronic
1042980652 8:74523276-74523298 GTACATTTGGTCTATAGTGCAGG - Intergenic
1043015652 8:74937501-74937523 GTCCATTTGGTCTATACTGAAGG + Intergenic
1043533458 8:81175217-81175239 GTCTATGTGGTCTCTTGTCCAGG + Intergenic
1044635146 8:94316268-94316290 TTCCATTTAGCCTATAGTGCAGG + Intergenic
1046233161 8:111384952-111384974 GTCCATTTGTTCTAGAGTACAGG + Intergenic
1048388821 8:133940640-133940662 GTCCATGAGATCAATAGTGGTGG - Intergenic
1051047496 9:12892184-12892206 GTCCATTTATTCTATAGTACAGG - Intergenic
1052212558 9:25923536-25923558 GTCCATTTGGTCTATAGCAGGGG - Intergenic
1054920805 9:70540660-70540682 GTCCAGGCTGTCTGTAGTGCTGG - Intronic
1058016567 9:100039165-100039187 GTCCATTTGGTTTATAGTGCAGG - Intronic
1061638570 9:131931974-131931996 GTCCATTTGTTCTGTAGTCCAGG - Intronic
1062021943 9:134323897-134323919 CTCCACGTGGTCTCTAGAGCAGG + Intronic
1187618424 X:21024150-21024172 ATCCACTTGGTCTATAGTGCAGG + Intergenic
1188729607 X:33630721-33630743 GTCCATGTGTGCTAGAATGCTGG - Intergenic
1189663736 X:43331089-43331111 GTACAGGTGGTCTAAAGTGTGGG - Intergenic
1189889964 X:45591052-45591074 GCCCATTTGGTCTATAGGGCAGG + Intergenic
1190459628 X:50659308-50659330 GTCCAAGTGATGTATAATGCAGG + Intronic
1190808000 X:53857546-53857568 GTCTATTTGGTCTATAGTGCCGG + Intergenic
1191148934 X:57199591-57199613 GTCTATTTGGTCTATACTGTGGG + Intergenic
1191972302 X:66830107-66830129 GTTCATTTGGTCTACAGTGCAGG - Intergenic
1192011149 X:67274514-67274536 GTCCATTTCATCTAAAGTGCAGG + Intergenic
1192194580 X:69019661-69019683 GTCCCTGTGGGCTAGGGTGCAGG - Intergenic
1192310485 X:70009102-70009124 GTCCATGGGATCAATAGTGATGG + Intronic
1192695357 X:73409063-73409085 GTCTCTTTGTTCTATAGTGCAGG - Intergenic
1193089297 X:77477034-77477056 ATCTATTTGGTCTATAGTGCAGG - Intergenic
1193504535 X:82325944-82325966 ATCCATTTGTTCTATAGTTCAGG + Intergenic
1193857022 X:86615706-86615728 GTCCATGTGGTATATAATACCGG - Intronic
1193887326 X:86998253-86998275 ATCCATTTGGTCTGTATTGCAGG - Intergenic
1194492076 X:94564042-94564064 CTGCATTTGGTCTATAGTGCAGG + Intergenic
1194546624 X:95242806-95242828 ATCCATTTGGTCTACAGTGCAGG - Intergenic
1194791288 X:98153872-98153894 GTCCATTTGGTCTACAGTTTTGG + Intergenic
1195653072 X:107306737-107306759 GTCCATTTGCTCTATAGTATTGG - Intergenic
1196289815 X:113926732-113926754 GTCCATTTGCTCTATAGTGAAGG + Intergenic
1197391689 X:125875010-125875032 GTCCATTTGGTCTATACTTCAGG + Intergenic
1201631606 Y:16076528-16076550 TTCCTTGTGGTATTTAGTGCTGG - Intergenic
1201863097 Y:18621142-18621164 ATCCATGTGGTCTTTTGAGCTGG - Intergenic
1201870226 Y:18699236-18699258 ATCCATGTGGTCTTTTGAGCTGG + Intergenic