ID: 1144620714

View in Genome Browser
Species Human (GRCh38)
Location 17:16816765-16816787
Sequence CTGTGTGGCTAAAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144620709_1144620714 -9 Left 1144620709 17:16816751-16816773 CCAGGGCAGGAGTCCTGTGTGGC No data
Right 1144620714 17:16816765-16816787 CTGTGTGGCTAAAGGGCAGTGGG No data
1144620704_1144620714 19 Left 1144620704 17:16816723-16816745 CCTGAGGTGGAAACAAGCAAAGT No data
Right 1144620714 17:16816765-16816787 CTGTGTGGCTAAAGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144620714 Original CRISPR CTGTGTGGCTAAAGGGCAGT GGG Intergenic
No off target data available for this crispr