ID: 1144625152

View in Genome Browser
Species Human (GRCh38)
Location 17:16840672-16840694
Sequence GGGTGAAATGGGAAGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144625152_1144625158 4 Left 1144625152 17:16840672-16840694 CCTCACTCCTTCCCATTTCACCC No data
Right 1144625158 17:16840699-16840721 GTCCCCAGTGCCCACTTCAGCGG No data
1144625152_1144625164 15 Left 1144625152 17:16840672-16840694 CCTCACTCCTTCCCATTTCACCC No data
Right 1144625164 17:16840710-16840732 CCACTTCAGCGGCCAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144625152 Original CRISPR GGGTGAAATGGGAAGGAGTG AGG (reversed) Intergenic
No off target data available for this crispr