ID: 1144628934

View in Genome Browser
Species Human (GRCh38)
Location 17:16860381-16860403
Sequence ATTAGTGAAGGGCCATCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144628934_1144628941 15 Left 1144628934 17:16860381-16860403 CCTCAGGATGGCCCTTCACTAAT No data
Right 1144628941 17:16860419-16860441 CCTTAGCTCAGGCTGGGAAACGG No data
1144628934_1144628938 8 Left 1144628934 17:16860381-16860403 CCTCAGGATGGCCCTTCACTAAT No data
Right 1144628938 17:16860412-16860434 TGTGTATCCTTAGCTCAGGCTGG No data
1144628934_1144628939 9 Left 1144628934 17:16860381-16860403 CCTCAGGATGGCCCTTCACTAAT No data
Right 1144628939 17:16860413-16860435 GTGTATCCTTAGCTCAGGCTGGG No data
1144628934_1144628937 4 Left 1144628934 17:16860381-16860403 CCTCAGGATGGCCCTTCACTAAT No data
Right 1144628937 17:16860408-16860430 GACATGTGTATCCTTAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144628934 Original CRISPR ATTAGTGAAGGGCCATCCTG AGG (reversed) Intergenic
No off target data available for this crispr