ID: 1144631033

View in Genome Browser
Species Human (GRCh38)
Location 17:16872589-16872611
Sequence TCTGTGCTGTGGGGAGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144631033_1144631039 -6 Left 1144631033 17:16872589-16872611 CCCAGGGCTCCCCACAGCACAGA No data
Right 1144631039 17:16872606-16872628 CACAGAGCCTGGTGCTTCCCTGG No data
1144631033_1144631044 24 Left 1144631033 17:16872589-16872611 CCCAGGGCTCCCCACAGCACAGA No data
Right 1144631044 17:16872636-16872658 CTTGATAACACATACTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144631033 Original CRISPR TCTGTGCTGTGGGGAGCCCT GGG (reversed) Intergenic