ID: 1144631039

View in Genome Browser
Species Human (GRCh38)
Location 17:16872606-16872628
Sequence CACAGAGCCTGGTGCTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144631029_1144631039 11 Left 1144631029 17:16872572-16872594 CCTGCTCCACGCTGTCTCCCAGG No data
Right 1144631039 17:16872606-16872628 CACAGAGCCTGGTGCTTCCCTGG No data
1144631028_1144631039 20 Left 1144631028 17:16872563-16872585 CCTCTGGGGCCTGCTCCACGCTG No data
Right 1144631039 17:16872606-16872628 CACAGAGCCTGGTGCTTCCCTGG No data
1144631033_1144631039 -6 Left 1144631033 17:16872589-16872611 CCCAGGGCTCCCCACAGCACAGA No data
Right 1144631039 17:16872606-16872628 CACAGAGCCTGGTGCTTCCCTGG No data
1144631034_1144631039 -7 Left 1144631034 17:16872590-16872612 CCAGGGCTCCCCACAGCACAGAG No data
Right 1144631039 17:16872606-16872628 CACAGAGCCTGGTGCTTCCCTGG No data
1144631032_1144631039 5 Left 1144631032 17:16872578-16872600 CCACGCTGTCTCCCAGGGCTCCC No data
Right 1144631039 17:16872606-16872628 CACAGAGCCTGGTGCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144631039 Original CRISPR CACAGAGCCTGGTGCTTCCC TGG Intergenic