ID: 1144631044

View in Genome Browser
Species Human (GRCh38)
Location 17:16872636-16872658
Sequence CTTGATAACACATACTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144631038_1144631044 13 Left 1144631038 17:16872600-16872622 CCACAGCACAGAGCCTGGTGCTT No data
Right 1144631044 17:16872636-16872658 CTTGATAACACATACTTTACTGG No data
1144631040_1144631044 0 Left 1144631040 17:16872613-16872635 CCTGGTGCTTCCCTGGTAACTGC No data
Right 1144631044 17:16872636-16872658 CTTGATAACACATACTTTACTGG No data
1144631033_1144631044 24 Left 1144631033 17:16872589-16872611 CCCAGGGCTCCCCACAGCACAGA No data
Right 1144631044 17:16872636-16872658 CTTGATAACACATACTTTACTGG No data
1144631034_1144631044 23 Left 1144631034 17:16872590-16872612 CCAGGGCTCCCCACAGCACAGAG No data
Right 1144631044 17:16872636-16872658 CTTGATAACACATACTTTACTGG No data
1144631036_1144631044 15 Left 1144631036 17:16872598-16872620 CCCCACAGCACAGAGCCTGGTGC No data
Right 1144631044 17:16872636-16872658 CTTGATAACACATACTTTACTGG No data
1144631037_1144631044 14 Left 1144631037 17:16872599-16872621 CCCACAGCACAGAGCCTGGTGCT No data
Right 1144631044 17:16872636-16872658 CTTGATAACACATACTTTACTGG No data
1144631041_1144631044 -10 Left 1144631041 17:16872623-16872645 CCCTGGTAACTGCCTTGATAACA No data
Right 1144631044 17:16872636-16872658 CTTGATAACACATACTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144631044 Original CRISPR CTTGATAACACATACTTTAC TGG Intergenic