ID: 1144631963

View in Genome Browser
Species Human (GRCh38)
Location 17:16878252-16878274
Sequence CTGGGCTGCCTGGCAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144631949_1144631963 8 Left 1144631949 17:16878221-16878243 CCTTCCTCTAGCCCCGGGGCCCT No data
Right 1144631963 17:16878252-16878274 CTGGGCTGCCTGGCAGGCACTGG No data
1144631951_1144631963 4 Left 1144631951 17:16878225-16878247 CCTCTAGCCCCGGGGCCCTCGGT No data
Right 1144631963 17:16878252-16878274 CTGGGCTGCCTGGCAGGCACTGG No data
1144631954_1144631963 -4 Left 1144631954 17:16878233-16878255 CCCGGGGCCCTCGGTGGACCTGG No data
Right 1144631963 17:16878252-16878274 CTGGGCTGCCTGGCAGGCACTGG No data
1144631956_1144631963 -5 Left 1144631956 17:16878234-16878256 CCGGGGCCCTCGGTGGACCTGGG No data
Right 1144631963 17:16878252-16878274 CTGGGCTGCCTGGCAGGCACTGG No data
1144631953_1144631963 -3 Left 1144631953 17:16878232-16878254 CCCCGGGGCCCTCGGTGGACCTG No data
Right 1144631963 17:16878252-16878274 CTGGGCTGCCTGGCAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144631963 Original CRISPR CTGGGCTGCCTGGCAGGCAC TGG Intergenic
No off target data available for this crispr