ID: 1144632428

View in Genome Browser
Species Human (GRCh38)
Location 17:16881012-16881034
Sequence CGGGGTCCCAGTGGGCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144632421_1144632428 -4 Left 1144632421 17:16880993-16881015 CCCGGGCAGGGCCTGGTGTCGGG No data
Right 1144632428 17:16881012-16881034 CGGGGTCCCAGTGGGCTTGCTGG No data
1144632414_1144632428 14 Left 1144632414 17:16880975-16880997 CCACTTCTCTGTTATAAGCCCGG No data
Right 1144632428 17:16881012-16881034 CGGGGTCCCAGTGGGCTTGCTGG No data
1144632423_1144632428 -5 Left 1144632423 17:16880994-16881016 CCGGGCAGGGCCTGGTGTCGGGG No data
Right 1144632428 17:16881012-16881034 CGGGGTCCCAGTGGGCTTGCTGG No data
1144632413_1144632428 18 Left 1144632413 17:16880971-16880993 CCTGCCACTTCTCTGTTATAAGC No data
Right 1144632428 17:16881012-16881034 CGGGGTCCCAGTGGGCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144632428 Original CRISPR CGGGGTCCCAGTGGGCTTGC TGG Intergenic
No off target data available for this crispr