ID: 1144638141

View in Genome Browser
Species Human (GRCh38)
Location 17:16923902-16923924
Sequence CGGGGTCCCAGTGGGCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144638125_1144638141 21 Left 1144638125 17:16923858-16923880 CCTGACCTGCCTCCTCTGTCATA 0: 1
1: 0
2: 1
3: 29
4: 277
Right 1144638141 17:16923902-16923924 CGGGGTCCCAGTGGGCTTGCTGG No data
1144638135_1144638141 -4 Left 1144638135 17:16923883-16923905 CCTGGGCAGGGCCTGGTGTCGGG No data
Right 1144638141 17:16923902-16923924 CGGGGTCCCAGTGGGCTTGCTGG No data
1144638129_1144638141 12 Left 1144638129 17:16923867-16923889 CCTCCTCTGTCATAAGCCTGGGC 0: 1
1: 0
2: 1
3: 19
4: 171
Right 1144638141 17:16923902-16923924 CGGGGTCCCAGTGGGCTTGCTGG No data
1144638130_1144638141 9 Left 1144638130 17:16923870-16923892 CCTCTGTCATAAGCCTGGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 152
Right 1144638141 17:16923902-16923924 CGGGGTCCCAGTGGGCTTGCTGG No data
1144638126_1144638141 16 Left 1144638126 17:16923863-16923885 CCTGCCTCCTCTGTCATAAGCCT 0: 1
1: 0
2: 4
3: 28
4: 238
Right 1144638141 17:16923902-16923924 CGGGGTCCCAGTGGGCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144638141 Original CRISPR CGGGGTCCCAGTGGGCTTGC TGG Intergenic
No off target data available for this crispr