ID: 1144638472

View in Genome Browser
Species Human (GRCh38)
Location 17:16925287-16925309
Sequence CCCCAGAGGGAGACTCCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144638459_1144638472 24 Left 1144638459 17:16925240-16925262 CCAGATAGGAGGGCTGGCGGGGC No data
Right 1144638472 17:16925287-16925309 CCCCAGAGGGAGACTCCGGAGGG No data
1144638463_1144638472 -7 Left 1144638463 17:16925271-16925293 CCCCAACCATTGACTGCCCCAGA No data
Right 1144638472 17:16925287-16925309 CCCCAGAGGGAGACTCCGGAGGG No data
1144638464_1144638472 -8 Left 1144638464 17:16925272-16925294 CCCAACCATTGACTGCCCCAGAG No data
Right 1144638472 17:16925287-16925309 CCCCAGAGGGAGACTCCGGAGGG No data
1144638462_1144638472 -6 Left 1144638462 17:16925270-16925292 CCCCCAACCATTGACTGCCCCAG No data
Right 1144638472 17:16925287-16925309 CCCCAGAGGGAGACTCCGGAGGG No data
1144638461_1144638472 2 Left 1144638461 17:16925262-16925284 CCAGGACACCCCCAACCATTGAC No data
Right 1144638472 17:16925287-16925309 CCCCAGAGGGAGACTCCGGAGGG No data
1144638465_1144638472 -9 Left 1144638465 17:16925273-16925295 CCAACCATTGACTGCCCCAGAGG No data
Right 1144638472 17:16925287-16925309 CCCCAGAGGGAGACTCCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144638472 Original CRISPR CCCCAGAGGGAGACTCCGGA GGG Intergenic
No off target data available for this crispr