ID: 1144638992

View in Genome Browser
Species Human (GRCh38)
Location 17:16927296-16927318
Sequence ATGGGCAGACATTGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144638981_1144638992 15 Left 1144638981 17:16927258-16927280 CCATCTCCTGGATGTGGGATCAG No data
Right 1144638992 17:16927296-16927318 ATGGGCAGACATTGCCATCTTGG No data
1144638984_1144638992 9 Left 1144638984 17:16927264-16927286 CCTGGATGTGGGATCAGGCTGGG No data
Right 1144638992 17:16927296-16927318 ATGGGCAGACATTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144638992 Original CRISPR ATGGGCAGACATTGCCATCT TGG Intergenic
No off target data available for this crispr