ID: 1144639531

View in Genome Browser
Species Human (GRCh38)
Location 17:16929985-16930007
Sequence TTTGGGGCCCTGAAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144639524_1144639531 0 Left 1144639524 17:16929962-16929984 CCCATGGATGCTGGGTCCTGGGC 0: 1
1: 1
2: 10
3: 35
4: 224
Right 1144639531 17:16929985-16930007 TTTGGGGCCCTGAAGGAGCAAGG 0: 1
1: 0
2: 2
3: 14
4: 247
1144639518_1144639531 13 Left 1144639518 17:16929949-16929971 CCTCCGGCAGCGGCCCATGGATG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1144639531 17:16929985-16930007 TTTGGGGCCCTGAAGGAGCAAGG 0: 1
1: 0
2: 2
3: 14
4: 247
1144639525_1144639531 -1 Left 1144639525 17:16929963-16929985 CCATGGATGCTGGGTCCTGGGCT 0: 2
1: 9
2: 27
3: 47
4: 332
Right 1144639531 17:16929985-16930007 TTTGGGGCCCTGAAGGAGCAAGG 0: 1
1: 0
2: 2
3: 14
4: 247
1144639519_1144639531 10 Left 1144639519 17:16929952-16929974 CCGGCAGCGGCCCATGGATGCTG 0: 1
1: 0
2: 0
3: 17
4: 155
Right 1144639531 17:16929985-16930007 TTTGGGGCCCTGAAGGAGCAAGG 0: 1
1: 0
2: 2
3: 14
4: 247
1144639516_1144639531 18 Left 1144639516 17:16929944-16929966 CCAGGCCTCCGGCAGCGGCCCAT 0: 1
1: 0
2: 3
3: 6
4: 168
Right 1144639531 17:16929985-16930007 TTTGGGGCCCTGAAGGAGCAAGG 0: 1
1: 0
2: 2
3: 14
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144639531 Original CRISPR TTTGGGGCCCTGAAGGAGCA AGG Intronic
900103892 1:974119-974141 CTTGGGACTCTGAGGGAGCAGGG + Intronic
900408248 1:2501807-2501829 TGTGGGGCCCTTGAGGGGCATGG - Intronic
900611468 1:3546369-3546391 TTGGGGGCCATGCAGGAGGAAGG - Intronic
900668975 1:3837821-3837843 TATGTGCCCCTGCAGGAGCACGG + Intronic
902092344 1:13913503-13913525 TTTGGGGCCCTGTAAGGTCAGGG + Intergenic
902238662 1:15074007-15074029 TCAGGGGCCCTGAAGGCGCTGGG - Intronic
902371360 1:16009139-16009161 TTTGAGACCCTCAAGGAGAAAGG + Intergenic
902971330 1:20054086-20054108 GTTGAGGCCATGGAGGAGCATGG - Intronic
903858597 1:26351947-26351969 TCTGGGGCCCTGCAGAAGAAAGG - Intronic
904676592 1:32202439-32202461 TTGGGGGCCCTGGAGTATCAGGG + Intronic
905494593 1:38374971-38374993 TTTGGGACCCCCAAGTAGCATGG + Intergenic
905881963 1:41469882-41469904 TTTCAGGCCCTGAGGGGGCATGG + Intergenic
905931456 1:41790840-41790862 CATGGGGCCATGAGGGAGCATGG - Intronic
908085054 1:60622987-60623009 TTAGGGGCCCTGAAGTTGTAGGG - Intergenic
908094404 1:60721745-60721767 TTTGGGGTCCTGGAGGATGATGG - Intergenic
910184340 1:84520604-84520626 TTTATGTCCCTGAAGGATCATGG + Intergenic
911060164 1:93740630-93740652 TTTTGGGGCGGGAAGGAGCAGGG - Intronic
915062223 1:153195569-153195591 TTTGGGGGTCTTAAGTAGCAAGG + Intergenic
915530704 1:156500745-156500767 TTTGGAGCCCGAAAGGAGGAAGG - Exonic
915656294 1:157363817-157363839 TTTGGGGCCCTGACAGGGAACGG + Intergenic
915941812 1:160123199-160123221 GGTGAGGCCCTGAGGGAGCAAGG - Exonic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
919086902 1:192931178-192931200 GTTTGGGCCCTGGAGCAGCAGGG - Intergenic
920840940 1:209553224-209553246 TTAGGGGCTCTGATAGAGCAGGG - Intergenic
922943790 1:229492747-229492769 TTTGGGGACCTGAAGGGGAAGGG + Intronic
923119828 1:230979330-230979352 TTTGGGGACCGCGAGGAGCAGGG + Intronic
924518701 1:244787411-244787433 TTTGGGGGCCTGAGGCAGGAGGG + Intergenic
924554551 1:245107559-245107581 TGTGGGGCACTGATGGGGCAGGG + Intronic
924642438 1:245847056-245847078 TCTGGGGAACTGAAGTAGCAAGG - Intronic
1063947594 10:11192541-11192563 TATGGGGAGGTGAAGGAGCAGGG - Intronic
1064858417 10:19797521-19797543 TTTGGGCCCCTGAACAAGGAGGG - Intergenic
1065236593 10:23658685-23658707 TTTGGGGTCTTAAAGGAGCTAGG - Intergenic
1065561676 10:26970193-26970215 TTTGGGGCCCTGATAGAGTTTGG + Intergenic
1067722919 10:48743250-48743272 TTTGGAGCCCTGGAGGAAGAGGG + Exonic
1068584410 10:58780628-58780650 TTTAGGGGCCTGAAGGAAGAAGG + Intronic
1070699316 10:78588182-78588204 TTTGGAGCCCAGAGGGAGCCAGG + Intergenic
1070782953 10:79148030-79148052 TCTGGGGGCCTGGAGGAGGAGGG + Intronic
1072407475 10:95168605-95168627 GTGGGGGGCCTGGAGGAGCAGGG + Intergenic
1076399672 10:130173426-130173448 TTTGGCGCCCAGCAAGAGCATGG - Intronic
1076465720 10:130680344-130680366 TTTGGTGGCCTGATGGAGGAGGG + Intergenic
1077155665 11:1089806-1089828 TTTGGGGCCCTGTGGGACCCGGG + Intergenic
1077393871 11:2311818-2311840 CTGGGGGCTCTGAAGGAGCCTGG - Intronic
1078339095 11:10486349-10486371 TTTGGGGGCCTGAGGAAGCAGGG + Intronic
1080644510 11:34178498-34178520 TGAGAGGGCCTGAAGGAGCAAGG + Intronic
1080943125 11:36941556-36941578 TTTGGGAACCAGAAGCAGCAAGG + Intergenic
1081807696 11:45899455-45899477 TGAGGGGGCCTGAAGGATCAGGG + Intronic
1084334223 11:68447346-68447368 CTTGGGTCCCTGGAGCAGCAGGG + Intronic
1084641664 11:70429965-70429987 TGTGTGGCCCTGCAGGGGCAGGG - Intronic
1085416298 11:76321270-76321292 TCTGAGACCCTGAGGGAGCAGGG + Intergenic
1086742406 11:90383974-90383996 ATTGGGACCATGAGGGAGCATGG + Intergenic
1089302552 11:117507414-117507436 TTTTGAGCCCTGAAAGTGCAGGG - Intronic
1089379089 11:118014884-118014906 TGGGGGGCCCTGAAGGAGGCTGG - Intergenic
1089786476 11:120910971-120910993 CATGGGGCCATGAAGGTGCAGGG + Intronic
1090079644 11:123603376-123603398 TCGGGGGACCTGAGGGAGCAAGG + Intronic
1090420911 11:126574304-126574326 TATGGGGCTCTGAAGGAGGTGGG - Intronic
1091785864 12:3243055-3243077 TTTGGAGGGATGAAGGAGCAGGG + Intronic
1092479195 12:8844881-8844903 CTTGGAGCCCTGCAGGAGCGTGG + Intronic
1095923736 12:47557752-47557774 TTTTTGGGCATGAAGGAGCAGGG - Intergenic
1095980891 12:47974155-47974177 ATTGGAGCCCTGGATGAGCAGGG + Exonic
1096261506 12:50095268-50095290 TTTGGGAACATGAAGGAGAAAGG + Intronic
1096362083 12:50996705-50996727 ATTAGGACCATGAAGGAGCAAGG - Intronic
1096687242 12:53296314-53296336 TTTGGGGGAGTGAAGGAGAAAGG - Intronic
1096699486 12:53372708-53372730 TTGAAGGCCCTGAAGGAGAAAGG - Intergenic
1098047181 12:66412005-66412027 TTGGGGTACCTGAAGGAGAAGGG + Intronic
1098953136 12:76662513-76662535 TGTTGGACCCTGAAGGACCAGGG - Intergenic
1099072336 12:78060945-78060967 TCTGGGGCCCTGATGGAGCAAGG - Intronic
1100209138 12:92383203-92383225 TATGGTGCCCTGAGGGAGGAGGG + Intergenic
1101036852 12:100715797-100715819 AGTGGGGCCCTCAAGGGGCAAGG + Intergenic
1101409415 12:104456775-104456797 TTTGGGACCCTGCGGGAGCGCGG + Intronic
1101438493 12:104684460-104684482 TTTGGAGCCATGGAGGGGCAGGG - Intronic
1102977967 12:117220202-117220224 TACCGAGCCCTGAAGGAGCAAGG - Exonic
1103946281 12:124528472-124528494 TTTGGGGCAAGGGAGGAGCATGG - Intronic
1105475096 13:20721911-20721933 GTTGGGGCCCAGCAGGAGCTTGG - Exonic
1105888931 13:24668177-24668199 TTTGGGTCCCCCAAGGAGGAGGG - Intergenic
1106060600 13:26287555-26287577 TTTGGGGACTTGGAGGAGAAAGG + Intronic
1106099205 13:26679989-26680011 TTGGGGGTGCTGAGGGAGCAGGG - Intronic
1106158817 13:27182820-27182842 TCTGGGGACCTGGAGGAGGAAGG - Intergenic
1106251242 13:27983169-27983191 TTTGGGGCACAGAAAGATCAAGG - Intronic
1106817541 13:33425410-33425432 ATTGGTGCCCTGAAGGGCCAGGG + Intergenic
1122694467 14:103546044-103546066 TTTAGGGCAATGAAGGAGAAAGG + Intergenic
1123445596 15:20328185-20328207 TTTGGGACCATGAAGCAGCTTGG - Intergenic
1126465079 15:48954564-48954586 TTTGCTGCACTGGAGGAGCAGGG + Intronic
1126695276 15:51320669-51320691 TTTGGGGACAGGAAGGAACAGGG - Intronic
1128324768 15:66717183-66717205 TGTGGGGCCCTTTGGGAGCATGG + Intronic
1128980304 15:72180679-72180701 CTTGGGGTCCTGAAAGAGCCTGG + Intronic
1129458624 15:75688918-75688940 TTTGGGGAGCTGCAGAAGCAGGG - Exonic
1129725168 15:77897954-77897976 TTCGGGGAGCTGAAGAAGCAGGG + Intergenic
1130224965 15:82049358-82049380 TCTGGGGTCCTAAAGGAGCCTGG - Intergenic
1130559503 15:84947100-84947122 TGTGGGGCTCACAAGGAGCAAGG - Intergenic
1133921133 16:10154192-10154214 TTGTGGGCCCAGATGGAGCATGG - Intronic
1134629080 16:15744026-15744048 TTTGGGAGCCTGAAGCAGGAGGG + Intronic
1134839788 16:17392591-17392613 TTTGGGGTCCTGAGAGAGAAGGG - Intronic
1135162916 16:20113431-20113453 TTTGGGGACCTGGAGGGGTAAGG + Intergenic
1136448351 16:30337674-30337696 TTTGGGCCATTGAAAGAGCATGG + Intergenic
1136450618 16:30352536-30352558 TTTTAGGCCCAGAAGGACCAGGG - Exonic
1139649991 16:68357433-68357455 TTTGGAGCCCTGGAGGGGCTGGG + Exonic
1139849742 16:69943776-69943798 TTCAGGGCCCTGAAGCAGCTGGG - Intergenic
1139878736 16:70166773-70166795 TTCAGGGCCCTGAAGCAGCTGGG - Intergenic
1140279295 16:73540406-73540428 TTTGGGGACCTGAAGAAAAAAGG - Intergenic
1140373780 16:74428719-74428741 TTCAGGGCCCTGAAGCAGCTGGG + Intergenic
1142047522 16:87935157-87935179 TTTGGGCCATTGAAAGAGCATGG - Intronic
1142105211 16:88299007-88299029 TGTGGGGCTCTGGAGGTGCAGGG - Intergenic
1142200245 16:88757678-88757700 TTCCTGGCCCTGAAGGAGCCAGG + Intronic
1143016160 17:3892386-3892408 TTCGGGGCCCGGGAGGCGCAGGG - Intronic
1144639531 17:16929985-16930007 TTTGGGGCCCTGAAGGAGCAAGG + Intronic
1144865549 17:18333183-18333205 TCTGAGGCCCTGACGGAGCTGGG - Exonic
1145281642 17:21472269-21472291 CTTGGGGTCCAGAAGCAGCAAGG - Intergenic
1145395794 17:22493354-22493376 CTTGGGGTCCAGAAGCAGCAAGG + Intergenic
1146510098 17:33439535-33439557 CTTGGGGAGCTGAAGAAGCAGGG - Intronic
1146932186 17:36785217-36785239 CTAGGGGCCCTGTGGGAGCAGGG - Intergenic
1147446516 17:40478278-40478300 TTTGGGGCCCTGAGACAGGAAGG + Intronic
1148793365 17:50185844-50185866 GTTGGAGCCCTGGAGGAGCAGGG + Exonic
1149063259 17:52449520-52449542 TTTGGGGTCATGCAAGAGCAGGG - Intergenic
1149453683 17:56770222-56770244 CTTGGAGGCCAGAAGGAGCAAGG - Intergenic
1152139259 17:78526673-78526695 TTGGGGTCGCTGAAGGAGAACGG + Exonic
1152570451 17:81119227-81119249 TCTGGGGCCGGGAAGGAGCGGGG + Intronic
1152641381 17:81450667-81450689 TTTGGTGCTCTGAGGGAGGATGG + Intronic
1158289053 18:55918245-55918267 TTAGGGGGCCTGAAGCAACATGG + Intergenic
1159950401 18:74478520-74478542 TCTGGGCCCATGAAGGAGCCAGG - Intergenic
1160353126 18:78201932-78201954 CATGGGGCTCTGTAGGAGCATGG - Intergenic
1161343008 19:3753027-3753049 TTTGGGGACCTGGAGGAGGTGGG - Intronic
1161542592 19:4861114-4861136 TTGGAGGGCCTGAGGGAGCAGGG - Intronic
1161801304 19:6418006-6418028 TTTGGGGACCGGAATGAGTACGG - Exonic
1162022438 19:7873999-7874021 TCTGAGTCCCTGAAGGGGCAAGG - Intronic
1162905081 19:13818399-13818421 TAGGGGGCCTTGAAGGGGCAGGG - Intronic
1163030598 19:14541626-14541648 TTTGGGGCCAGGGAGGAGAATGG + Intronic
1167436460 19:49481320-49481342 ACTGGGGACCTGAAGGAGCAAGG + Intronic
1168272140 19:55255781-55255803 TGTGGGGGCCTGAAGGACCCAGG - Intronic
926189439 2:10717196-10717218 CTTTGGGCCCTGAAGAAGGATGG + Intergenic
926353462 2:12018552-12018574 TCTGCTGCCCTGCAGGAGCACGG + Intergenic
928107201 2:28478172-28478194 TTTGGGAGACTGAAGGGGCATGG - Intronic
929538004 2:42796531-42796553 TTTGGAGCCCGGAAGAACCAGGG - Intergenic
929714062 2:44292960-44292982 TTTGGGGCCAGGGAGGAGGATGG + Intronic
930019710 2:46994182-46994204 TTGGAGGGACTGAAGGAGCAAGG + Intronic
931940954 2:67252013-67252035 TTTGAGCCCCTGAGGGAGAAAGG + Intergenic
933283027 2:80353807-80353829 TTTAGTGCCCTGGAGCAGCAAGG + Intronic
935217832 2:100988738-100988760 AGTGGGGGCCTGGAGGAGCAGGG - Intronic
935217844 2:100988775-100988797 AATGGGGGCCTGGAGGAGCAGGG - Intronic
935217863 2:100988830-100988852 AGTGGGGGCCTGGAGGAGCAGGG - Intronic
935217918 2:100988978-100989000 AGTGGGGGCCTGGAGGAGCAGGG - Intronic
938288707 2:130138296-130138318 TGTGGGGCCCCCAGGGAGCAGGG + Intergenic
938310532 2:130285933-130285955 TTGGGCCCCCTGGAGGAGCAGGG + Intergenic
938467826 2:131534636-131534658 TGTGGGGCCCCCAGGGAGCAGGG - Intergenic
940042980 2:149379667-149379689 TCTGTGGTTCTGAAGGAGCATGG - Intronic
940594895 2:155778725-155778747 TTAGGGCCCATGAAGGGGCAAGG - Intergenic
943218085 2:185065279-185065301 TTTTTAGCCATGAAGGAGCATGG + Intergenic
943789730 2:191918569-191918591 TTGGGAGCCCAGAAGGAGCCGGG + Intergenic
946397941 2:219452702-219452724 GTTGGTGCCCTGAAGGAGGCTGG + Intronic
948490615 2:238310315-238310337 TGTGGGTGCCTGAAGGAGGAAGG - Intergenic
1168754948 20:310000-310022 TTTGGGGGCTTGGAGGAGGAGGG - Intergenic
1170500120 20:16966890-16966912 TCTGAGGCCCAGAAGAAGCAAGG - Intergenic
1170572256 20:17639009-17639031 TTTAGGGCCCAGAAGGAGATGGG - Intronic
1172807286 20:37621491-37621513 TTTGGGGGGCTGAAGGAGAAGGG - Intergenic
1172843887 20:37918210-37918232 TATGTGGCCCAGCAGGAGCAAGG + Intronic
1174163384 20:48567516-48567538 TCTGGGGCCCTGAAGCAGGTGGG - Intergenic
1175718171 20:61269259-61269281 TTAGTGGCCCTGGAGGAGCCAGG + Intronic
1175913252 20:62414439-62414461 GTGGGGGCTCTGAAGGTGCAGGG + Exonic
1176083783 20:63286723-63286745 TTTGGAACCCTGCAGGAGCTGGG + Intronic
1176232735 20:64040363-64040385 TTGAGGGCCCTGAGGGAGCTGGG + Intronic
1177058398 21:16338456-16338478 TTTGGGGCACTGAAGGTACTGGG + Intergenic
1178008988 21:28260232-28260254 TTTGTGGCCTTGAAGAATCAAGG - Intergenic
1178315174 21:31560825-31560847 TTTGGGGCACTGAAAAAACATGG + Intergenic
1178399536 21:32273391-32273413 ATTGGGGGCCAGAAGGACCAAGG - Intronic
1179168992 21:38958138-38958160 TTTGAGGCCAAGAGGGAGCAGGG + Intergenic
1179479604 21:41668994-41669016 TCCGGGGCCCTGTAGGAGCCGGG + Intergenic
1180007131 21:45028012-45028034 TCTGGGGCCCAGGGGGAGCAGGG - Intergenic
1181312350 22:21952331-21952353 ACTGGGCCCCTGAAGGTGCAGGG + Intronic
1182515915 22:30859027-30859049 CATGGGGCCCTGAAGGGGTAGGG - Intronic
1182551329 22:31102384-31102406 ATAGAGGCCCAGAAGGAGCAAGG + Intronic
1183160568 22:36110430-36110452 GTTGGGACCCTGGAGGAGGAAGG + Intergenic
1183398235 22:37585486-37585508 GGTGGGGCCTTGAAGGAGGAAGG + Intergenic
1184539635 22:45112130-45112152 TTTTGGCCCCTGAAGTAGGAAGG + Intergenic
1184874719 22:47266925-47266947 TTTTGGCACCTGAAGCAGCAGGG - Intergenic
1185005924 22:48277012-48277034 GATGGGGCCCTGGAGGAGGATGG - Intergenic
950120489 3:10479280-10479302 TCTTGGGGGCTGAAGGAGCAAGG - Intronic
950475408 3:13211595-13211617 TTTGGGGCCATGGAGAGGCAAGG - Intergenic
951954861 3:28242559-28242581 TTCGGAGCCTTCAAGGAGCATGG + Intronic
952052496 3:29401625-29401647 TTTGGTGTCATAAAGGAGCATGG + Intronic
953735661 3:45491942-45491964 TTTGGGGCCCTTTAAGAGAAGGG + Intronic
954413638 3:50382240-50382262 TGGGGGTCCCTGAAGGAGGAAGG - Intronic
954692740 3:52404317-52404339 TTTGGGGCCCTGGGGGAGGCTGG - Intronic
956120458 3:65960820-65960842 TTTGTGGCCATATAGGAGCAAGG - Intronic
960921434 3:122750714-122750736 TGTGGGGCACTAAAGGAGAAAGG + Intronic
961222452 3:125211860-125211882 TTTGGGGCCCTTCTGGAGCAGGG + Intronic
961575680 3:127834241-127834263 TTTGGGGCCATTAACGAGCATGG + Intergenic
963112845 3:141701079-141701101 TCTGGGGCCCTGCAGGCCCATGG - Intergenic
964308578 3:155367891-155367913 TTTGGGGCCCTCAAGAAGAAAGG + Intergenic
967056271 3:185831510-185831532 TTTGGGAGCCTGAAGCAGGAGGG + Intergenic
967468068 3:189830791-189830813 TTTGGGACTTTGAAGGAGGAAGG + Intronic
967857888 3:194132092-194132114 TTTGGTGCCCTGAAGGTGCATGG - Intergenic
968477790 4:820574-820596 TTTGGTGCCGGGAAGGAGGAAGG + Intronic
968612510 4:1563641-1563663 GTGGGGGCACTGGAGGAGCAAGG + Intergenic
968730964 4:2269013-2269035 TGTGGGGCCCTGTCTGAGCAGGG - Intergenic
968891849 4:3373585-3373607 TTCGGGGTCCCAAAGGAGCATGG - Intronic
968972225 4:3802053-3802075 CTTGGGGCCTGGGAGGAGCATGG - Intergenic
971940601 4:33210092-33210114 TTTGGGGACTTGATGGAGAAGGG + Intergenic
972066589 4:34953423-34953445 TTTGGGCGCCAGCAGGAGCATGG - Intergenic
976725556 4:88212612-88212634 TTTTAGGCCCTGGTGGAGCAAGG - Intronic
981111536 4:140940123-140940145 ATTTGGGCCCTGAAGGATCTGGG + Intronic
981602095 4:146501383-146501405 TTATGTGCCCTGAAGGAGAAAGG - Intronic
982660852 4:158205036-158205058 TTTGGGAGGCTGAAGGAGGAAGG + Intronic
984838068 4:184040578-184040600 ATCGGGGCCCTGAGGGAGAAGGG + Intergenic
985888658 5:2699458-2699480 TCTGGGACCCCGAGGGAGCAGGG + Intergenic
985944581 5:3167992-3168014 TTTGGCTTCCTGAAGTAGCAAGG + Intergenic
986098287 5:4581775-4581797 ATTAGGGCCCTGTAGGAGAATGG - Intergenic
987037521 5:14033065-14033087 TGTGGGGGCCTAAGGGAGCAGGG - Intergenic
987665747 5:20936827-20936849 TGTGGAACCCTCAAGGAGCATGG + Intergenic
992207190 5:74442448-74442470 TTTGGAGCCCAGAAGCAGGAAGG + Intergenic
993019675 5:82576733-82576755 ATTGGTGCCCTTAAAGAGCATGG - Intergenic
995713211 5:115055352-115055374 GATGGGGCCCTGAAAGACCAAGG + Intergenic
995836559 5:116405583-116405605 AGTGGGGCACTGAATGAGCAAGG - Intronic
998605610 5:143631772-143631794 ATTGGGGTCCTGCAGGAACAGGG - Intergenic
998815920 5:146013938-146013960 TATGGCGCCCTGAAGGAGAATGG - Exonic
999368231 5:151036844-151036866 TTGGGAGCCCAGAAGGAGCAGGG - Exonic
1000608506 5:163350100-163350122 ATTGGGGCCAGGAAGGAGAAAGG - Intergenic
1002382220 5:178839142-178839164 CTGGAGGCCCTGAAGTAGCAAGG + Intergenic
1003934394 6:10960347-10960369 TGTGTGCCCCTGAAAGAGCATGG - Intronic
1004033809 6:11901704-11901726 TTTGGCGTCTTGGAGGAGCAGGG - Intergenic
1008031273 6:46697515-46697537 TTTGGGAAACTGAAGTAGCATGG + Intronic
1010454096 6:76035132-76035154 CTAGGGGCACTGAAGGAGCAGGG + Intronic
1011189363 6:84713875-84713897 TTTGTTCTCCTGAAGGAGCATGG + Intronic
1013463486 6:110398128-110398150 TTAGGGGCACTCAAGAAGCAGGG + Intronic
1016452074 6:144193747-144193769 TTCAAGGCCCTGAAGGAGCCAGG + Intergenic
1017212734 6:151875282-151875304 TTTGGGGTCCTGAGGTAGAATGG + Intronic
1017375630 6:153764496-153764518 TTAGAGGCTCAGAAGGAGCAGGG + Intergenic
1017543580 6:155427729-155427751 TTTGGGGCTCTGGAAGAACAGGG - Intronic
1022067087 7:26869698-26869720 TTTTGTGCCCTGTAGGAGCTGGG - Intronic
1022665987 7:32410825-32410847 CTTGTGGGCCTGAAGGAGCAAGG - Intergenic
1023180381 7:37476402-37476424 TTTGGTGCCCAGAATGGGCAAGG + Intergenic
1023821247 7:43981791-43981813 TGAGGGGCCCCGCAGGAGCAGGG - Intergenic
1026415208 7:70172267-70172289 TCTGTGGACCTGAAAGAGCAAGG + Intronic
1026895646 7:74008529-74008551 TGTTGGGCCCTGAAGGACCCAGG - Intergenic
1029222388 7:99000726-99000748 TGGGGTGTCCTGAAGGAGCAGGG + Intronic
1029749516 7:102535215-102535237 TGAGGGGCCCCGCAGGAGCAGGG - Intergenic
1029767464 7:102634318-102634340 TGAGGGGCCCCGCAGGAGCAGGG - Intronic
1029854075 7:103495659-103495681 TTTGGGGCCTCGAGGGAGAATGG - Intronic
1033509988 7:142050940-142050962 CATGGGTCCCTGAAGGACCAGGG + Intronic
1036802402 8:11802477-11802499 ATTGGTGCCCTGATGGAGCCGGG - Exonic
1036996807 8:13667432-13667454 GTTGGGGACCTGAAGTAGCTGGG + Intergenic
1039811774 8:41055311-41055333 ACTGGGGCCCTGAAAGAGCAGGG + Intergenic
1040119299 8:43663882-43663904 TTTGGGCCCCTTAAGGACTATGG + Intergenic
1040433177 8:47363938-47363960 TTTGGGGACATGAAGGAACGTGG + Intronic
1041427480 8:57738840-57738862 TGTTGGGCCTTGAAAGAGCAGGG - Intergenic
1043287402 8:78550818-78550840 TTTGGGGTCTTGAGGGAGAAAGG - Intronic
1048326599 8:133443845-133443867 AATGAGGCCCTGATGGAGCAAGG - Intergenic
1048688074 8:136926710-136926732 TCTGGGTCCCTGTAGGACCATGG - Intergenic
1049433572 8:142576186-142576208 CTTGGGACCCACAAGGAGCAAGG - Intergenic
1050008348 9:1158551-1158573 TTTGTGGCTCTGAATGAGGAGGG + Intergenic
1052039941 9:23726931-23726953 TTTAGGGACCTGAAGGATCTTGG + Intronic
1056439078 9:86602584-86602606 TGTGCGGAGCTGAAGGAGCATGG + Intergenic
1057024000 9:91722259-91722281 CTGGGGGCCCTGGAGCAGCAGGG - Intronic
1057141212 9:92727784-92727806 GGTGGGGCCCTGAAGGAGGCAGG - Intronic
1057699691 9:97354823-97354845 TTTTGGACTCTGAAGGAGGAGGG - Intronic
1058523523 9:105835271-105835293 TAAGGGGCTGTGAAGGAGCATGG - Intergenic
1060205943 9:121682940-121682962 TAGGGGGCCCTGAATGAGGATGG + Intronic
1061373468 9:130210944-130210966 TTTGGGAGGCTGAAGGAGGAGGG - Intronic
1061423315 9:130483907-130483929 TTTCTGGCCCAGAAGGAACAAGG + Intronic
1061574819 9:131499599-131499621 TTGGTGGCCCTGGTGGAGCATGG - Exonic
1187064721 X:15822342-15822364 TTTGGGTCCCTGTGGTAGCACGG - Intronic
1192364050 X:70455970-70455992 CTTGAGGCACTGAAGGAGCATGG - Intronic
1192369706 X:70503362-70503384 TATGAGGTCCTGAAGGAGCCAGG + Exonic
1193241530 X:79175878-79175900 TTTGGGGTCCTGAAAGTGCTAGG - Intergenic
1201460190 Y:14213904-14213926 TCTGGGGGTCTGAAGGATCAAGG - Intergenic
1202058697 Y:20863529-20863551 TTTGGGGCCATGAACATGCATGG + Intergenic