ID: 1144641121

View in Genome Browser
Species Human (GRCh38)
Location 17:16937391-16937413
Sequence ATTGAAGCTGGGGTTGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144641117_1144641121 -4 Left 1144641117 17:16937372-16937394 CCACAAGATTATTTGTGTGATTG 0: 1
1: 0
2: 1
3: 17
4: 177
Right 1144641121 17:16937391-16937413 ATTGAAGCTGGGGTTGAGCCTGG 0: 1
1: 0
2: 0
3: 20
4: 215
1144641115_1144641121 10 Left 1144641115 17:16937358-16937380 CCAAAGAAACACCACCACAAGAT 0: 1
1: 0
2: 1
3: 21
4: 229
Right 1144641121 17:16937391-16937413 ATTGAAGCTGGGGTTGAGCCTGG 0: 1
1: 0
2: 0
3: 20
4: 215
1144641116_1144641121 -1 Left 1144641116 17:16937369-16937391 CCACCACAAGATTATTTGTGTGA 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1144641121 17:16937391-16937413 ATTGAAGCTGGGGTTGAGCCTGG 0: 1
1: 0
2: 0
3: 20
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144641121 Original CRISPR ATTGAAGCTGGGGTTGAGCC TGG Intronic