ID: 1144642066

View in Genome Browser
Species Human (GRCh38)
Location 17:16943104-16943126
Sequence TCTGTCATGCAGATGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144642066 Original CRISPR TCTGTCATGCAGATGGTGCT GGG (reversed) Intronic
900563198 1:3318761-3318783 TTAGTCATCCAGATGATGCTGGG - Intronic
904376086 1:30083375-30083397 TCTGTCCTGCAGATGGAGAAAGG - Intergenic
904843338 1:33388699-33388721 TCTGTGCTGCACATGGTGCTGGG - Intronic
904902467 1:33868227-33868249 TCAGTCATCAAGATGGTGATGGG - Intronic
906121408 1:43394456-43394478 TTTTTCATGCAGCTGGTCCTTGG + Intronic
906247644 1:44288398-44288420 TCTCTCATGAAGATGGGGCTGGG - Intronic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
910149719 1:84127062-84127084 TATGCCATGCAGATGAAGCTGGG - Intronic
910265195 1:85331028-85331050 TCTGTTATGCAGCTGCTGGTTGG + Intronic
910374341 1:86552665-86552687 TCGGACTTGCAGATGGAGCTGGG + Intronic
911015209 1:93324855-93324877 TCTGTAATGCAGAGGCTACTTGG + Intergenic
911764874 1:101661905-101661927 ACTGTCATGAACCTGGTGCTGGG + Intergenic
914898696 1:151699407-151699429 TCTGCCATGCAGATAGAGCCTGG + Intergenic
915909148 1:159901492-159901514 TATGTCATGCAGATGTGCCTGGG - Intergenic
916391420 1:164334799-164334821 TCTCTCATACAGAAGGTACTTGG + Intergenic
917081222 1:171258640-171258662 TCTGTAATGCAGACGGAGCCAGG - Intronic
922161207 1:223080321-223080343 TCTGTGATGCAGTAGATGCTGGG - Intergenic
923261172 1:232269390-232269412 ACTGTCCTGGAGATGATGCTGGG + Intergenic
923538687 1:234872485-234872507 TCTGACATGCAGCAGGTACTGGG + Intergenic
1062877090 10:951752-951774 TCTGTTATGCAGTTGATTCTGGG - Intergenic
1062877094 10:951804-951826 TATGTTATGCAGTTGGTTCTGGG - Intergenic
1062877099 10:951856-951878 TATGTTATGCAGTTGGTTCTGGG - Intergenic
1062877104 10:951908-951930 TATGTTATGCAGTTGGTTCTGGG - Intergenic
1062877109 10:951960-951982 TATGTTATGCAGTTGGTTCTGGG - Intergenic
1062877173 10:952433-952455 TCTGTTATGCAGTTGGGTCTGGG - Intergenic
1062877180 10:952485-952507 TCTGTTATGCAGTTGGTTGTGGG - Intergenic
1062877186 10:952537-952559 TCTTTTATGCAGTTGGTTCTGGG - Intergenic
1062877192 10:952589-952611 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877198 10:952641-952663 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877204 10:952693-952715 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877210 10:952745-952767 TCTGTTATGCAGTTGGTTGTGGG - Intergenic
1062877216 10:952797-952819 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877222 10:952849-952871 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877228 10:952901-952923 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877234 10:952953-952975 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877240 10:953005-953027 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877246 10:953057-953079 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877252 10:953109-953131 TCTGTTATGCAGTTGGTTGTGGG - Intergenic
1062877258 10:953161-953183 TCTGTTATGCAGTTGGTTGTGGG - Intergenic
1062877264 10:953213-953235 TCTGTTATGCAGTTGGTTGTGGG - Intergenic
1062877270 10:953265-953287 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877276 10:953317-953339 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877282 10:953369-953391 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877288 10:953421-953443 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877294 10:953473-953495 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877311 10:953629-953651 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877316 10:953681-953703 TCTGTTATGCACTTGGTTCTGGG - Intergenic
1066658780 10:37720096-37720118 TCTGAGATGCAGAGGGGGCTGGG - Intergenic
1067043176 10:42969338-42969360 TCTGAGATTCAGATGGGGCTGGG - Intergenic
1067688089 10:48479754-48479776 CCTGTCTTGCAGGTGGTGCCGGG - Exonic
1069978314 10:72233451-72233473 CCTGTCATCCATATGGTGCCTGG + Exonic
1073863752 10:107776838-107776860 TTTGTCATGCAGTTGCAGCTAGG - Intergenic
1075645839 10:124095447-124095469 TCCGTTATGGAGATGGCGCTGGG + Intergenic
1075703484 10:124484259-124484281 TCTGGCAGGCAGCTGGTGCCGGG - Exonic
1075838451 10:125476455-125476477 TCTATGATGAAGTTGGTGCTAGG + Intergenic
1076024417 10:127100379-127100401 TGTGGCATGCAGCTGGGGCTTGG + Intronic
1076505052 10:130966445-130966467 TCTGTGCTGGAGATGGGGCTGGG - Intergenic
1076893800 10:133298780-133298802 TCTGTGCTGGACATGGTGCTAGG - Intronic
1077920993 11:6641597-6641619 CTTGTCATGCAGAAGGAGCTGGG - Exonic
1083244739 11:61417883-61417905 TCTGTCATGCTGATGGACCTGGG - Intronic
1088327404 11:108615383-108615405 ACTGTCATGCTGATTGTGTTAGG + Intergenic
1096716055 12:53492366-53492388 CCTGGCACGCAGAAGGTGCTCGG + Intronic
1096974791 12:55693878-55693900 TCTGTCCTGCATATGGACCTTGG - Intronic
1101732130 12:107435543-107435565 TGTCTCATGCAGTTGGTGCAGGG + Intronic
1103025020 12:117566643-117566665 TCAGTCATTCAGATAGTGATGGG + Intronic
1103992987 12:124811746-124811768 TTTGTCGTGAAGAGGGTGCTGGG - Intronic
1105730242 13:23207226-23207248 TCTGTTCAACAGATGGTGCTGGG + Intronic
1106031204 13:26005745-26005767 TCTCTCCAGCAAATGGTGCTGGG - Intronic
1106075902 13:26460945-26460967 TCTGGGATGCAGTTGCTGCTAGG - Intergenic
1107416933 13:40209711-40209733 TCTGTAGGGTAGATGGTGCTTGG - Intergenic
1107514932 13:41119812-41119834 TCTCTTCAGCAGATGGTGCTGGG - Intergenic
1108437975 13:50420170-50420192 TGTGTCTTGCAGATTCTGCTTGG + Intronic
1108707254 13:53000860-53000882 TCTGGCCTGCAGATGGAGCAAGG + Intergenic
1110876148 13:80512740-80512762 TCTGTTAGGGTGATGGTGCTTGG - Intergenic
1115954440 14:38762437-38762459 CCTTTCTTGCAGATGGTGCATGG - Intergenic
1116106352 14:40513243-40513265 TATGCCATGCAGCTGCTGCTAGG - Intergenic
1117056005 14:51912521-51912543 TTTGTCCTGGAGATGGTGTTAGG - Intronic
1118467555 14:66044732-66044754 TCTGTGGTGCAGATGCTGGTGGG + Intergenic
1119343845 14:73904919-73904941 TCTGTCCTGCAGAAGGTTGTGGG + Exonic
1121227871 14:92334634-92334656 TCTGTCTTGAAGATGGTAGTTGG + Intronic
1122270296 14:100565974-100565996 TCTGTCCTGCATTTGGTGCCTGG - Intronic
1122419524 14:101566697-101566719 TCAGCCATCCAGATGGTGCCAGG - Intergenic
1123848980 15:24334463-24334485 TCAATTATGCATATGGTGCTAGG + Intergenic
1123868034 15:24541977-24541999 TCAATCATGCATATGGTGCTAGG + Intergenic
1124087835 15:26568403-26568425 TCTGTCATGGTGGTGGTGGTAGG - Intronic
1124553997 15:30708925-30708947 TCTGTCACCCAGATGGGGGTGGG - Intronic
1124677250 15:31696746-31696768 TCTGTCACCCAGATGGGGGTGGG + Intronic
1128616992 15:69118034-69118056 CAAGTCATGCAGATGCTGCTGGG - Intergenic
1130602569 15:85286608-85286630 TCAGTGATACAGATGGGGCTGGG + Intergenic
1132282967 15:100635898-100635920 TTTGTCATGGAGAAGGTTCTGGG + Intronic
1132614981 16:835949-835971 TCTGTAATGGGGGTGGTGCTGGG + Intergenic
1134381996 16:13736216-13736238 TCTGACATTCAGATGGACCTAGG - Intergenic
1137763152 16:50956915-50956937 TCTGTCATTGTGATGGTACTGGG + Intergenic
1138929698 16:61637582-61637604 TGTGTCCTGCACAAGGTGCTTGG - Intergenic
1139021920 16:62760580-62760602 TCTGTCAAGCATATGGATCTGGG + Intergenic
1139195942 16:64918582-64918604 ACTCTCCTGCAGGTGGTGCTGGG - Intergenic
1142884438 17:2903920-2903942 TCTGTCATGAAGAAGGTGTGGGG + Intronic
1143131260 17:4678933-4678955 TCTGTCATGCAGAGGCTCCAGGG - Intronic
1143720296 17:8804471-8804493 TCTGTCATAGAGGAGGTGCTCGG - Intronic
1144158010 17:12526788-12526810 TCTGTTCAACAGATGGTGCTGGG - Intergenic
1144642066 17:16943104-16943126 TCTGTCATGCAGATGGTGCTGGG - Intronic
1144721045 17:17470184-17470206 ACAGTCATGCAGCTGGTGGTGGG - Intergenic
1145259744 17:21347556-21347578 TCTGTGATGCATATGGTCCTGGG + Intergenic
1145316871 17:21740392-21740414 TCTGTGATGCATATGGTCCTGGG - Intergenic
1148391227 17:47274663-47274685 GCTGTCATGGGGATGTTGCTGGG + Intronic
1151785957 17:76275223-76275245 TCTGTCATCAAGGGGGTGCTGGG - Intronic
1152390927 17:80003225-80003247 TCTGTCATGCAGTTCCTGCCAGG - Intronic
1156021679 18:32606568-32606590 TGTGTCATGGAGTTGCTGCTAGG + Intergenic
1156854691 18:41768133-41768155 TCTGTCCAGCGGGTGGTGCTAGG + Intergenic
1157092703 18:44654786-44654808 TATGTGATGCAGACGGTGCATGG + Intergenic
1159277561 18:66240667-66240689 TCTATCAGGTAAATGGTGCTAGG + Intergenic
1160570220 18:79811481-79811503 TCTCTTCAGCAGATGGTGCTGGG + Intergenic
1162222753 19:9192127-9192149 TCTGCCATGCAGCTGCTGCAGGG - Intergenic
1162872776 19:13598818-13598840 TCTGTCATGTAGTTGCTGCTGGG - Intronic
1164069566 19:21754545-21754567 TCTGTTAAGTAAATGGTGCTGGG + Intronic
1164792682 19:31001610-31001632 TCTGTAATGCAGGTGGAGGTCGG + Intergenic
926172137 2:10559133-10559155 ACTGTCATGCAGCTGCTGCGCGG + Intergenic
930861071 2:56073147-56073169 TGTGTCAATAAGATGGTGCTGGG + Intergenic
935147057 2:100402805-100402827 TCTGTCCAACAAATGGTGCTGGG + Intronic
937503406 2:122508722-122508744 TCTGTTATGCACAAGGTACTGGG - Intergenic
937810066 2:126189305-126189327 CCTGTCTTGCACTTGGTGCTTGG - Intergenic
937953461 2:127405950-127405972 TCTGGCCTGCAGATGGTGTGGGG - Intergenic
938329795 2:130441536-130441558 TCTGAGATGCAGGTGGTGCCAGG + Intergenic
938360151 2:130679967-130679989 TCTGAGATGCAGGTGGTGCCAGG - Intergenic
938436554 2:131286674-131286696 TCTGAGATGCAGGTGGTGCCAGG - Intronic
941127939 2:161609410-161609432 CCTGTTAAGCAAATGGTGCTGGG - Intronic
942610096 2:177734584-177734606 TCTGTCATGAAGAGTGTTCTAGG - Intronic
944937234 2:204582014-204582036 TTTGGCATGCAGAAGGAGCTTGG + Intronic
945032982 2:205682445-205682467 TCTGACATCCACATGCTGCTCGG + Intronic
947810593 2:233001488-233001510 TCAGGCATGTAGAGGGTGCTGGG + Intronic
1169142566 20:3234537-3234559 CCTGTCCTGCAGGTGGTCCTGGG - Intronic
1171052669 20:21874452-21874474 TCTGTGATGGGGATGGAGCTGGG + Intergenic
1171390549 20:24799015-24799037 GCTGTAATGAAGATGGTGCTTGG - Intergenic
1174171604 20:48621157-48621179 TCTGTCCAGCAGGTGGTGCTGGG - Intergenic
1174278669 20:49422288-49422310 GCTGCCATGGAGATGGAGCTGGG + Intronic
1174433509 20:50488670-50488692 TCTGAAATGCAGATGGTAATAGG + Intergenic
1175268256 20:57715353-57715375 TCTGGCCTGCAGTGGGTGCTTGG + Intergenic
1176139590 20:63539142-63539164 TCTCCCATGCAGATGGAGCTGGG + Intergenic
1177467462 21:21506119-21506141 TCTCACATGCAGATAGTTCTAGG - Intronic
1178251548 21:31008224-31008246 ACTCTCATGGATATGGTGCTTGG + Intergenic
1181167896 22:20993098-20993120 TGGGGCAGGCAGATGGTGCTGGG + Intronic
1181760098 22:25052276-25052298 GCTGTCTTGCAGAGGGTGCCTGG + Intronic
1182475795 22:30575610-30575632 TCTGTCATGCACACGGCGATGGG - Intergenic
1185386065 22:50531812-50531834 TCCGTGTTGCAGATGGGGCTTGG - Intronic
949606133 3:5656334-5656356 TGTGTCATGTAGCTGGTGATAGG - Intergenic
950907026 3:16548103-16548125 TCTGTCATTTGGATGTTGCTGGG + Intergenic
953666690 3:44930665-44930687 CCTGTCACCCACATGGTGCTTGG - Intronic
954745648 3:52786109-52786131 CCTGGCTTGCAGAGGGTGCTTGG + Intronic
955011120 3:55015336-55015358 TCTGTTTTGCAGATGGTGAATGG - Intronic
960230335 3:115219003-115219025 TCTGTCAGGTACATGATGCTGGG + Intergenic
961919765 3:130413632-130413654 TCTCCCATGTAGGTGGTGCTGGG + Intronic
962883182 3:139598518-139598540 TGTGTCTGGCAGTTGGTGCTGGG - Intronic
963686192 3:148437385-148437407 TCTGTCAAGCAGGGGGAGCTAGG - Intergenic
966899392 3:184469440-184469462 TCTGACATGCAGAGGGTCCGGGG + Intronic
967039878 3:185681824-185681846 TCTATTCAGCAGATGGTGCTGGG + Intronic
967811461 3:193764734-193764756 TCTGTCCTGCTGGTGGTGTTGGG + Intergenic
968438423 4:608408-608430 TCTGTGAGGCAGACGCTGCTCGG + Intergenic
969229435 4:5819595-5819617 TCTGTCTTAGAGAAGGTGCTAGG + Intronic
969523239 4:7691136-7691158 TCTGTGTGGCAGATGGTGCTGGG - Intronic
971223408 4:24729990-24730012 TCTGTCATCCAGATGGAACTTGG - Intergenic
971683598 4:29734484-29734506 TCTGTCATGCAGATGAAACCAGG - Intergenic
973327548 4:48878632-48878654 TGTGCCATGCAGATGGTTCAGGG + Intergenic
973618518 4:52704439-52704461 TCTGTCATGCAGGTGAAACTTGG - Intergenic
975231265 4:71936314-71936336 TTTATAATGCAAATGGTGCTGGG + Intergenic
975727939 4:77310283-77310305 TCTGTAATTCAAATGTTGCTGGG - Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976095920 4:81508098-81508120 TGTGCCATGCACAAGGTGCTAGG + Intronic
979233540 4:118373669-118373691 TCTGTCTTGTAGAGGTTGCTGGG - Intergenic
979797814 4:124869248-124869270 TCTCTCATCCTGATGTTGCTAGG - Intergenic
979940749 4:126759049-126759071 TCTGTCATGCAGATGCTGTCGGG + Intergenic
984866281 4:184283509-184283531 GCTGTCCTGCAGATGGTGACAGG + Intergenic
985773642 5:1828237-1828259 TCTGTTAGGCAGATTGGGCTTGG + Intergenic
986039720 5:3980846-3980868 TTTGGCTTGCAGATGGTGGTTGG + Intergenic
986084192 5:4426719-4426741 TCTGCCCTGCAGAGGGTGATTGG + Intergenic
986728824 5:10619856-10619878 TCCGGCAGACAGATGGTGCTGGG - Intronic
987858686 5:23455426-23455448 TCTCTCATGGAGATGGAACTAGG - Intergenic
988411724 5:30894441-30894463 TATGTGCTGCAGATGATGCTGGG - Intergenic
992554256 5:77888054-77888076 TCTGTCATGGAGGCAGTGCTGGG - Intergenic
995166977 5:109055073-109055095 TCTGCCTGACAGATGGTGCTGGG + Intronic
996906698 5:128609020-128609042 TCTGCCATGCAGCTGCTGCGGGG + Intronic
997619091 5:135273141-135273163 ACTGCCAGGCACATGGTGCTGGG + Intronic
1001919798 5:175590912-175590934 CCTTTCATGCAGAGGCTGCTAGG - Intergenic
1002614011 5:180439198-180439220 ACTGGCATGGAGATGGGGCTGGG - Intergenic
1002760141 6:195404-195426 TCTGTTCAGCAGATGGTGCTGGG + Intergenic
1002902089 6:1417666-1417688 TCTGCAATGCAGTTGGAGCTGGG - Intergenic
1004431805 6:15551749-15551771 CCTGTCATGGAGTTGGCGCTCGG + Intronic
1004941778 6:20566222-20566244 TCTGTCATGCAGATTTTGCCTGG + Intronic
1005501995 6:26436756-26436778 TCAGTCATTCAGATGATGATGGG - Intergenic
1005510328 6:26506724-26506746 GCTGTCATCCTGATGGTTCTAGG + Exonic
1006479974 6:34284294-34284316 TCTGAAATGCAGATGGGACTAGG + Exonic
1007967405 6:46015535-46015557 TCTGTCATGCCGTTGGCGCCCGG + Intronic
1008255073 6:49288601-49288623 TCTGTCATGCAGAAGCTTTTTGG + Intergenic
1010328676 6:74595338-74595360 TGGGTCATGCAGAGGGTACTTGG - Intergenic
1011706747 6:90008248-90008270 TCTGTCTTTCAGATGGTGTAAGG - Intronic
1018887286 6:167950747-167950769 TCTGCAGTGGAGATGGTGCTGGG + Intronic
1019198477 6:170296040-170296062 TTTGTCATGGAGATGGGGCGCGG - Intronic
1021582127 7:22167220-22167242 TCTGCCATGCACATGGTTCTGGG - Intronic
1025105977 7:56172476-56172498 TCTTTCATGGAGAAGGTACTAGG - Intergenic
1026315275 7:69222190-69222212 TCTTTCATGGAGAAGGTACTAGG - Intergenic
1027614765 7:80408287-80408309 TCTTTTAAGCAAATGGTGCTAGG - Intronic
1029724292 7:102392051-102392073 TCTGTCACAGAGCTGGTGCTTGG - Intronic
1031119275 7:117703069-117703091 TCTGCCTTGCAGAAGGTGCTTGG - Intronic
1031260395 7:119511139-119511161 TCTGTGAAACACATGGTGCTGGG + Intergenic
1031358015 7:120812129-120812151 TCTGTAATAGACATGGTGCTAGG - Intronic
1035328960 7:158084203-158084225 TCTCTGCTGCTGATGGTGCTGGG - Intronic
1035379521 7:158428878-158428900 ACCGTCATGCAGATCGTCCTGGG + Intronic
1035938363 8:3868117-3868139 TCTGCCAAGCAGAAAGTGCTAGG - Intronic
1036448567 8:8844915-8844937 TTTGTCATGCAGATAGTTTTGGG - Intronic
1036706769 8:11052483-11052505 TCTGGCATGCAGATGGCGCGAGG + Intronic
1037346590 8:17907653-17907675 GCTGCCCTGCTGATGGTGCTTGG - Intronic
1038353083 8:26798796-26798818 TTTGTCATGGGGATGGTGGTAGG - Intronic
1041288996 8:56290614-56290636 TCTGTCCTGGAGATGGTGGGTGG + Intergenic
1041952863 8:63523976-63523998 GCTGACATGCAGTAGGTGCTTGG - Intergenic
1042904291 8:73757401-73757423 TCAGGCCTGCAGATGATGCTGGG - Intronic
1043367626 8:79553745-79553767 TCTGTCCTTCAGAATGTGCTGGG - Intergenic
1043384576 8:79735402-79735424 CCTGTCCTGCAGATGGTGCTAGG + Intergenic
1044934319 8:97278258-97278280 TCTGTCATGAAGAAAGTGCTCGG + Intergenic
1046298517 8:112255279-112255301 TATGTCAAGCAGATGGCACTTGG - Exonic
1050245706 9:3687821-3687843 TCTGTCATTCAGAAGGTGAAAGG - Intergenic
1050319259 9:4434243-4434265 TCTGGCATACAGCAGGTGCTTGG - Intergenic
1052697489 9:31896742-31896764 TATGTCATGTATATTGTGCTAGG - Intergenic
1053157781 9:35792259-35792281 GCTGGGATGCAGAAGGTGCTGGG - Exonic
1053864640 9:42423989-42424011 TGTGTCAGGCAAAGGGTGCTGGG - Intergenic
1055325313 9:75122225-75122247 TCTGTCATGTAAAGGTTGCTGGG + Intronic
1055977844 9:81971987-81972009 ACTTGCATGCAGATGGGGCTTGG - Intergenic
1055997491 9:82176187-82176209 TCTGTCCTTCAATTGGTGCTTGG - Intergenic
1057166635 9:92932486-92932508 TCAGTCTAGCAGATGGTCCTGGG + Intergenic
1057884771 9:98821973-98821995 TCTGACATGCGGTAGGTGCTCGG + Intronic
1058576970 9:106414211-106414233 TTTTTCATGCAGATGATGCACGG - Intergenic
1059086399 9:111307454-111307476 TGGTTCATGGAGATGGTGCTGGG - Intergenic
1059350731 9:113662985-113663007 TTTCTTATCCAGATGGTGCTTGG + Intergenic
1060558671 9:124524603-124524625 TCTTTCATGCAGTTGGTGATGGG + Intronic
1060815903 9:126635021-126635043 GCTGGCATGCAGCGGGTGCTAGG - Intronic
1061485264 9:130917395-130917417 ATGGTCCTGCAGATGGTGCTGGG + Intronic
1186086727 X:5998510-5998532 TGTTTCATACACATGGTGCTAGG - Intronic
1187269182 X:17764615-17764637 TCTGACATTCAGAGGGTTCTTGG - Intergenic
1187320335 X:18232048-18232070 TCTGACATTCAGAGGGTTCTTGG + Intergenic
1188749891 X:33892590-33892612 TGTTTCTTGCAGATGGTTCTTGG + Intergenic
1189279408 X:39810623-39810645 TCTGTCAAGCAGAAGGTGCCAGG - Intergenic
1190949854 X:55132769-55132791 TCTCTCATAAAGATTGTGCTGGG - Intronic
1191039948 X:56068380-56068402 TCTGCCATCCAGGTGTTGCTTGG - Intergenic
1191115233 X:56845251-56845273 TGTGTCATGCAGCTGCTGTTGGG - Intergenic
1194647751 X:96479133-96479155 TCTATTATACAGATTGTGCTAGG + Intergenic
1198708820 X:139478988-139479010 TCTGTAAAGCTGATGGTTCTAGG + Intergenic
1199066791 X:143428743-143428765 TCTGATATGCAGTAGGTGCTTGG + Intergenic
1199738778 X:150711708-150711730 TTGGCCATGCAGCTGGTGCTGGG + Intronic
1202273338 Y:23091385-23091407 TCTGTCATTTGGATGTTGCTGGG + Intergenic
1202292688 Y:23329297-23329319 TCTGTCATTTGGATGTTGCTGGG - Intergenic
1202426335 Y:24725129-24725151 TCTGTCATTTGGATGTTGCTGGG + Intergenic
1202444454 Y:24944957-24944979 TCTGTCATTTGGATGTTGCTGGG - Intergenic