ID: 1144643219

View in Genome Browser
Species Human (GRCh38)
Location 17:16950812-16950834
Sequence CACTATGAGCAGAGGCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144643219_1144643221 -9 Left 1144643219 17:16950812-16950834 CCTCTGAGCCTCTGCTCATAGTG 0: 1
1: 0
2: 1
3: 30
4: 253
Right 1144643221 17:16950826-16950848 CTCATAGTGCCCTTTCTTCCAGG 0: 1
1: 0
2: 1
3: 12
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144643219 Original CRISPR CACTATGAGCAGAGGCTCAG AGG (reversed) Intronic
901480212 1:9519909-9519931 CAGCATGTGCAAAGGCTCAGAGG + Intergenic
901690725 1:10971477-10971499 CAGTATGTGCAGAGGCCCTGAGG - Intronic
902271661 1:15309386-15309408 CCCCATGAGCAGAGGGGCAGAGG - Intronic
902364905 1:15966460-15966482 CAGTGTGGACAGAGGCTCAGAGG - Intronic
902679508 1:18033178-18033200 CAGAATGAGCAAAGGCTAAGAGG - Intergenic
902948532 1:19862024-19862046 CAGTATGTGCAAAGGCCCAGAGG - Intergenic
903275620 1:22219479-22219501 CAGTATGTGCAAAGGCCCAGAGG - Intergenic
903293516 1:22329370-22329392 CACTGTGTGCAGAGGCCCTGGGG - Intergenic
903661163 1:24979727-24979749 CAGCATGGGCAAAGGCTCAGAGG + Intergenic
904454015 1:30636129-30636151 CAACATGGGCAAAGGCTCAGAGG + Intergenic
905872119 1:41410716-41410738 CAGTGTGAGCAAAGGCACAGAGG + Intergenic
906025129 1:42666958-42666980 CTGTGTGAGCAAAGGCTCAGGGG - Intronic
906044700 1:42819092-42819114 CACTTTCAACAGTGGCTCAGTGG - Intronic
906578323 1:46911359-46911381 CAGTATGAGAAGAGGGTTAGGGG - Intergenic
907462672 1:54614559-54614581 CAGCATGTGCAAAGGCTCAGAGG + Intronic
907831336 1:58066991-58067013 CAGCATGAGCAAAGGCTCTGAGG - Intronic
911285466 1:95986713-95986735 CAACATGAGCAAAGGCACAGGGG + Intergenic
911699365 1:100933336-100933358 TACTATGAGCAAAGGTACAGGGG - Intronic
911784753 1:101932400-101932422 CACTATGAGCAGATCTTCGGAGG + Intronic
912209652 1:107544201-107544223 AGCTATGAGCAGAGCCTCAAAGG - Intergenic
912883183 1:113439366-113439388 CAGTATGTGCAAAGGCACAGAGG - Intronic
914338494 1:146738582-146738604 CACTGTGTGCAGAAGCCCAGGGG + Intergenic
915744875 1:158148159-158148181 CAGGCTGAGCAGAGGCTCAAGGG - Intergenic
915906391 1:159881012-159881034 CACCATGAGCAAAGCCACAGGGG - Intronic
916274663 1:162980688-162980710 CACTCTGAGCAGTGACTTAGTGG + Intergenic
916676067 1:167065354-167065376 CAGCATGTGCAAAGGCTCAGAGG + Intronic
919683066 1:200455130-200455152 CACCATGCGCAGAGGCCCTGTGG - Intergenic
921751524 1:218799992-218800014 GACTTTGAGCAGAGACTCTGGGG + Intergenic
924658896 1:245998129-245998151 CACTGTGAGCCAAGCCTCAGAGG - Intronic
1063625564 10:7686402-7686424 CAGTATGAGCAAAGGCTCCCAGG - Intergenic
1064429316 10:15257454-15257476 CACGAGAAGCAGAGGATCAGGGG - Intronic
1067449997 10:46376278-46376300 AACTGTGTGCAGAGGGTCAGAGG + Intronic
1067570101 10:47365285-47365307 CACTTTGAGCTGAGCCTCAAAGG - Intergenic
1067587247 10:47483485-47483507 AACTGTGTGCAGAGGGTCAGAGG - Intronic
1067634305 10:47991252-47991274 AACTGTGTGCAGAGGGTCAGAGG - Intergenic
1067794818 10:49313309-49313331 CACCATGAGCAGAGGCCCTGAGG + Intronic
1068601872 10:58965253-58965275 CAGAATGTGCAAAGGCTCAGTGG - Intergenic
1068654561 10:59561361-59561383 AATTATCAGCAGAGGCTGAGTGG - Intergenic
1069993712 10:72329926-72329948 CAGCATGAGCAGAGGCCCGGAGG - Intergenic
1070803564 10:79257282-79257304 GTGTATTAGCAGAGGCTCAGAGG - Intronic
1071402067 10:85283182-85283204 CATTATGACAAGTGGCTCAGAGG + Intergenic
1072030995 10:91522379-91522401 CACAATGAGCCCAGGCGCAGTGG + Intergenic
1072827251 10:98619673-98619695 CATTATGAGCAAAGGCACAGAGG - Intronic
1073737070 10:106361083-106361105 CAGTATTATCTGAGGCTCAGGGG + Intergenic
1074562075 10:114543815-114543837 CAATACCTGCAGAGGCTCAGAGG - Intronic
1074790447 10:116881247-116881269 GACTTTGGGCAGAGGCTTAGCGG - Intronic
1075260622 10:120960648-120960670 CAGTATGATCAGAGGCTCACAGG - Intergenic
1076497300 10:130905496-130905518 CAGTAGGGGCAGAGGCTCGGCGG - Intergenic
1078162945 11:8857634-8857656 CAGCATGAGCAAAGGCCCAGAGG - Intronic
1079164951 11:18031736-18031758 CAATATGAGCAAAGGTTCAGAGG - Intronic
1080693553 11:34580835-34580857 CAGCATGAGCAAAGGCTCAGGGG + Intergenic
1084228051 11:67729769-67729791 CATTCTGAGCAGAGGCTCTTTGG + Intergenic
1084844256 11:71887105-71887127 CATTGTGACCAGAGGCTCAATGG - Intronic
1085282527 11:75340537-75340559 CACTACGAGGAGAGGCTGTGGGG + Intronic
1085352842 11:75811280-75811302 CAGCATGAGCAAAGGCACAGGGG - Intergenic
1085719255 11:78898524-78898546 CAGTCTGAGCAGAGGCCTAGCGG - Intronic
1085758692 11:79223464-79223486 ACCTCTGAGCAGAGGCCCAGAGG - Intronic
1085905243 11:80752564-80752586 CAGTATAAGCAAAGGCTCTGAGG + Intergenic
1086817749 11:91394242-91394264 CCGTATGAACAGAGGGTCAGAGG - Intergenic
1087572452 11:99946350-99946372 AACTAGGAACAGAGGCTTAGTGG + Intronic
1087981271 11:104617503-104617525 CTCTATGGGCATAGGCTCAAGGG + Intergenic
1088057143 11:105597774-105597796 CACTATCAACTGAGGGTCAGAGG + Intergenic
1088318666 11:108532744-108532766 CAAAATGTGCATAGGCTCAGAGG - Intronic
1089064885 11:115655266-115655288 CCCTTTGAGCAAAGACTCAGAGG + Intergenic
1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG + Exonic
1089782907 11:120886557-120886579 CACCATGACCAGAGGCTCACAGG + Intronic
1090071324 11:123546943-123546965 CAGTAGGAGCAGGGCCTCAGTGG + Intronic
1091354037 11:134922004-134922026 CACCATGAGGAGAGGCTCCTAGG - Intergenic
1093424236 12:19010491-19010513 CAGTATGACCAGAGGAGCAGAGG + Intergenic
1093920510 12:24854920-24854942 CACTATGGGTGAAGGCTCAGCGG - Intronic
1096838528 12:54367179-54367201 CAGTATGTGTAGAGGCGCAGAGG + Intergenic
1098079203 12:66766071-66766093 CACTATGAAAATATGCTCAGAGG + Intronic
1099698006 12:86045112-86045134 CACTATGAGCAGATCTTCAGAGG - Intronic
1100341658 12:93684901-93684923 CCACATCAGCAGAGGCTCAGTGG + Intronic
1100361527 12:93884107-93884129 TACCAGGAGCAGAGGCTCACTGG + Intronic
1101529398 12:105560322-105560344 CAGCATGAGCAAAAGCTCAGAGG - Intergenic
1101733950 12:107448869-107448891 CACAATGAGTAGAGGCTCTGGGG - Intronic
1102028862 12:109728575-109728597 CAGTCTGAGCAAAGGCACAGAGG - Intronic
1103164725 12:118760719-118760741 CAATATTGCCAGAGGCTCAGGGG - Intergenic
1104284753 12:127414736-127414758 CACTATGAGCCGTATCTCAGTGG - Intergenic
1104723482 12:131060257-131060279 CTCTATGAGCAAAGGCTGAGTGG - Intronic
1104893596 12:132151549-132151571 GACCATGAGCAGGGCCTCAGGGG - Exonic
1107006544 13:35618976-35618998 CAATATGAGCAGAGCCACACTGG - Intronic
1111251934 13:85613054-85613076 CTCCATGAGCAGAGGAACAGAGG - Intergenic
1115914879 14:38301401-38301423 CACTTTGAGCAGATCTTCAGAGG + Intergenic
1116704137 14:48275215-48275237 TTCTATGAGCAGAGACTGAGTGG - Intergenic
1116864048 14:50017105-50017127 CACAATGAGAAGAGGGGCAGAGG + Intergenic
1116874031 14:50093641-50093663 AAATATGAGCAGAGGAGCAGAGG - Intergenic
1116985171 14:51211231-51211253 CACTATGAGCAGTGGTTTACTGG + Intergenic
1117116573 14:52519744-52519766 AACTGTGTGCAGAGGCTCTGAGG - Intronic
1118400851 14:65378312-65378334 CACCAGGAGCAGAGGGCCAGTGG + Intergenic
1118570251 14:67187749-67187771 CAGTCTGAGCAAAGGCACAGAGG - Intergenic
1122160782 14:99782298-99782320 CCCTAGGACCAGAGGCTCAGGGG - Intronic
1125544893 15:40495997-40496019 CAGCATGTGCAGAGGCTCTGTGG - Intergenic
1128712315 15:69881387-69881409 GACTATGAGGAGAGGCCCAGGGG - Intergenic
1129163963 15:73764894-73764916 CACTCTGATGAGAAGCTCAGAGG - Intergenic
1133020773 16:2966055-2966077 CACTTTGAGCATAGGCTGCGGGG + Intronic
1133678488 16:8098268-8098290 TACTATGAGCAAATGCTCTGGGG - Intergenic
1135679213 16:24442455-24442477 AGGTAAGAGCAGAGGCTCAGAGG - Intergenic
1135859086 16:26038570-26038592 GCCCATGAGCAGAGGCTCAGGGG - Intronic
1135861964 16:26064389-26064411 GACCATGAGCAAAGGCTCAGAGG + Intronic
1136083358 16:27867561-27867583 CACAGTGAGCAAGGGCTCAGTGG - Intronic
1138483157 16:57317441-57317463 CAGCATGAGCTGAGGCTCAGAGG + Intergenic
1139995784 16:70978772-70978794 CACTGTGTGCAGAAGCCCAGGGG - Intronic
1141285204 16:82665422-82665444 AACTGTGACCAGAGGCTCACAGG + Intronic
1141479484 16:84296835-84296857 CAGCATGAGCCGAGGCTCACAGG + Intronic
1141571988 16:84939906-84939928 CACCTGGAGCAGAGGTTCAGTGG + Intergenic
1142546551 17:707979-708001 CACAGTGAGCAGAGACTCACAGG - Intronic
1142684979 17:1572324-1572346 CACTCGGAGCAGCAGCTCAGGGG - Intronic
1142687772 17:1587558-1587580 CACTCGGAGCAGCAGCTCAGGGG - Intronic
1142948000 17:3451008-3451030 CTATATGAGGAGAGGCTGAGTGG + Intronic
1142956617 17:3527237-3527259 CAGCATGAGCAAAGGCTCGGAGG - Intronic
1144640446 17:16933855-16933877 CACTATGAATAGAGGCAAAGAGG + Intronic
1144643219 17:16950812-16950834 CACTATGAGCAGAGGCTCAGAGG - Intronic
1145274050 17:21419631-21419653 CAGCACCAGCAGAGGCTCAGGGG - Exonic
1145311913 17:21705530-21705552 CAGCACCAGCAGAGGCTCAGGGG - Intergenic
1146629983 17:34462902-34462924 CAAGATGAGCAAATGCTCAGAGG - Intergenic
1147877919 17:43634688-43634710 CAAGATGAGCACAGACTCAGTGG + Intergenic
1148161428 17:45452249-45452271 GCCTATGAGCAAAGGCTCTGGGG + Intronic
1150392664 17:64798895-64798917 GCCTATGAGCAAAGGCTCTGGGG + Intergenic
1151538417 17:74751540-74751562 CACTCAGGGCAGAGGCTGAGGGG + Intronic
1152120329 17:78414504-78414526 CTCTCTGGGGAGAGGCTCAGTGG + Intronic
1153227770 18:2910966-2910988 CACTCTGAGCAGAGGCCTGGAGG - Intronic
1153891292 18:9517957-9517979 CTCTCTAAGCAGAGGCTCAGTGG + Intronic
1157100439 18:44724358-44724380 CACTGAGATTAGAGGCTCAGGGG - Intronic
1158068911 18:53447111-53447133 CAGTGTGATCAGAGGCTCACAGG + Intronic
1158340695 18:56462846-56462868 CACCATGAGCAGAGCCCCAGAGG - Intergenic
1160135181 18:76265778-76265800 CACCATTAGCAGAGACTCACAGG + Intergenic
1160303811 18:77712422-77712444 AAAAATGAGCAGAGCCTCAGAGG + Intergenic
1161365136 19:3874610-3874632 CACTGTGACTAGAGGCTCACAGG - Intergenic
1162410185 19:10501104-10501126 CAGTAAGTGCAGTGGCTCAGAGG + Intronic
1162797485 19:13094413-13094435 CACTAGGGGCAGAGTCTCTGAGG + Intronic
1165322366 19:35094027-35094049 CCAGAAGAGCAGAGGCTCAGGGG - Intergenic
1166740389 19:45111193-45111215 CAGCATGTGCAAAGGCTCAGAGG - Intronic
1167492246 19:49799537-49799559 CAGAAAGACCAGAGGCTCAGAGG + Intronic
1168251460 19:55144659-55144681 CAGTGTGTGCAAAGGCTCAGGGG + Intronic
1168517375 19:57018777-57018799 CAATATGTGCAAAGGCCCAGAGG - Intergenic
927154675 2:20214582-20214604 CACCGTGTGCAGAGGCTGAGAGG - Intronic
928225540 2:29445091-29445113 CCTTTTCAGCAGAGGCTCAGGGG - Intronic
928235644 2:29537253-29537275 CCCTCTGATCACAGGCTCAGAGG + Intronic
929175118 2:38968171-38968193 AACTAGGAGCAGTGGCTAAGAGG + Intronic
929875893 2:45796061-45796083 CAGCATGAGCAAAGGCACAGAGG - Intronic
930104025 2:47626214-47626236 CAGTGTAAGCAAAGGCTCAGAGG + Intergenic
931095949 2:58941543-58941565 GACTATGAGCAGATGAGCAGTGG - Intergenic
931908349 2:66867712-66867734 CACAGTGAGGAGAGGCTGAGTGG - Intergenic
932437824 2:71713174-71713196 CGCTTGGAGCAGAGGCACAGCGG + Intergenic
932477521 2:72015892-72015914 CATTGTGATCAGAGGCTCATAGG - Intergenic
932782594 2:74570664-74570686 CAACATGAGCAAAGGCTCAAAGG + Intronic
934712528 2:96525376-96525398 CACTCTAAGCAGGAGCTCAGAGG + Intergenic
935199045 2:100840077-100840099 CAGTATGAGCAAAGGCCCCGGGG - Intronic
936171048 2:110175070-110175092 CATTGTGACCAGAGGCTCACAGG + Intronic
936520425 2:113208802-113208824 GACCATGACTAGAGGCTCAGAGG - Intronic
938885023 2:135637304-135637326 CAGTATGTACAGAGGCCCAGAGG + Intronic
939226527 2:139371582-139371604 TACAATGAGCAGAGGCCCATTGG + Intergenic
940240125 2:151553617-151553639 CATTATGCAAAGAGGCTCAGGGG + Intronic
941277640 2:163510323-163510345 CACTATGACCACAAGCTCAGGGG - Intergenic
948598886 2:239096979-239097001 CACTTTCAGAAGGGGCTCAGGGG + Intronic
1168876378 20:1174851-1174873 CAGCATGAGCAGAGGCTCAGAGG - Intronic
1169405055 20:5315808-5315830 CACGCTGAGCAGAGGCTGCGGGG - Intergenic
1170113757 20:12834470-12834492 CATTGTGATCAGAGGCTCTGGGG + Intergenic
1172874350 20:38155239-38155261 CACTATGAACTGGGGCTTAGCGG - Intronic
1173393701 20:42658162-42658184 CATTGTGAGCAGAGGCTCACAGG - Intronic
1173943907 20:46934771-46934793 CAGCATGAGCAAAGGCCCAGAGG + Intronic
1174093222 20:48066725-48066747 CTCTGGAAGCAGAGGCTCAGGGG + Intergenic
1175774832 20:61646526-61646548 GACAATGAGCTGAGGCCCAGAGG - Intronic
1176520729 21:7822154-7822176 CACAATGTGTAGAGGCTCTGGGG - Intronic
1176789407 21:13302062-13302084 CACATGGAGCAGAGGCTGAGTGG - Intergenic
1177732307 21:25043435-25043457 CACTAACAGCAGAAGCCCAGGGG + Intergenic
1177988568 21:28010253-28010275 CACATGGAGCAGAGGCTGAGTGG - Intergenic
1178654753 21:34452166-34452188 CACAATGTGTAGAGGCTCCGGGG - Intergenic
1179993572 21:44961453-44961475 CGCTAGGACTAGAGGCTCAGAGG - Intronic
1181079402 22:20403954-20403976 CAGCATGTGCAGAAGCTCAGAGG - Intronic
1181733874 22:24867025-24867047 CACTGTGCGGAGGGGCTCAGAGG - Intronic
1182765964 22:32758911-32758933 CACTATGGGCAGATAGTCAGGGG - Intronic
1183379208 22:37482494-37482516 TAGCATGCGCAGAGGCTCAGAGG - Intronic
1184019097 22:41808620-41808642 CACTTAGAGCACAGGGTCAGTGG - Intronic
1184261058 22:43316617-43316639 CACCAGGAGCTGAGCCTCAGGGG + Intronic
955662355 3:61314804-61314826 CAGCATGTGCAAAGGCTCAGTGG - Intergenic
955819942 3:62886060-62886082 CCCTGGGAACAGAGGCTCAGGGG + Intergenic
956882765 3:73527931-73527953 CACGATGAGCAGATGTTCATTGG + Intronic
957710405 3:83850527-83850549 TACTAGGTGCAGAGGCTTAGAGG + Intergenic
958153680 3:89725436-89725458 CCCCATCAGCAGAGGCTGAGTGG + Intergenic
958544412 3:95523616-95523638 CACTATGAGATCAGGCACAGTGG + Intergenic
959440088 3:106363153-106363175 CACTCTGAGCAGATTTTCAGAGG - Intergenic
960529639 3:118748601-118748623 TACCATGAGCAAAGGCACAGAGG - Intergenic
961876731 3:130028872-130028894 CATTCTGAGCAGAGGCTCTTTGG + Intergenic
963947347 3:151160949-151160971 CACTATGGGAAGAGGCCCAGAGG + Intronic
967830303 3:193912875-193912897 AAGTCTGAGCAGAGGCTCAAAGG - Intergenic
968986460 4:3877974-3877996 CACTTGGAGCAGAGACTCCGAGG + Intergenic
969061225 4:4436869-4436891 CAGCATGAGCAAATGCTCAGAGG - Intronic
969228589 4:5814716-5814738 CATCATGAGCAAAGGCCCAGTGG - Intronic
970422483 4:15918517-15918539 CAGCATGAGCAAGGGCTCAGAGG - Intergenic
970733518 4:19137548-19137570 CCCTCTGAGCAGACCCTCAGTGG - Intergenic
975344474 4:73278065-73278087 CACAATGAGGACAGGCGCAGTGG - Intergenic
979913424 4:126399999-126400021 GTTTATGAGGAGAGGCTCAGAGG - Intergenic
980006810 4:127552191-127552213 CCCTCTGATCAGAGGCCCAGAGG + Intergenic
980116197 4:128681236-128681258 CACTCTAAGCAGTGGATCAGAGG - Intergenic
980302647 4:131014204-131014226 CACTCTTAGCAGAGGTTCTGAGG - Intergenic
980905430 4:138944081-138944103 CAGTAAGAGCAAAGGCACAGAGG + Intergenic
981373483 4:143987191-143987213 CTCCATGAGCAGAAGATCAGAGG + Intergenic
981934733 4:150227546-150227568 CAGTCTGAGCAAAGGCCCAGAGG + Intronic
982656769 4:158159894-158159916 CACTTTGAGCACTGGCTGAGCGG + Intronic
984843727 4:184092415-184092437 CACTCTGGGCAGAGGCACAGTGG - Intronic
985772182 5:1819044-1819066 CACTATCAGCAGAGCCTCAAAGG - Intergenic
987555232 5:19437739-19437761 TACCATGAGCAAAGGCACAGAGG - Intergenic
993257917 5:85616997-85617019 CCCTATCATCACAGGCTCAGAGG - Intergenic
996246016 5:121264258-121264280 CACTCTGAGCAGATCTTCAGAGG - Intergenic
997718766 5:136061812-136061834 CCCCATGATCTGAGGCTCAGAGG - Intronic
998750770 5:145319064-145319086 CTCCATGAGCAGAGGAGCAGAGG - Intergenic
999247692 5:150163924-150163946 CAGTATGAACAGAGGCCCTGAGG - Intergenic
999641010 5:153673169-153673191 CATTCTGAGCAAAGGCCCAGAGG - Intronic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1000450686 5:161382935-161382957 CAGGATGAGCAGAGGCTCTTTGG - Intronic
1002174733 5:177395398-177395420 CAGTATGTGCAAAGGCTCAGAGG + Intronic
1002513806 5:179741843-179741865 CAATATGTGCAGATGCTCAGAGG - Intronic
1002571326 5:180140835-180140857 CAGCATGTGCAGAGGCTCGGCGG + Intronic
1006919621 6:37618890-37618912 CACTTTTAGGAGAGGCTCAGAGG - Intergenic
1011007554 6:82664006-82664028 CAGTATGAGCTGAGGCCCAGAGG - Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1011656429 6:89556027-89556049 CACTCTGACAAGAGGCACAGAGG + Intronic
1016769700 6:147835547-147835569 CACTATTGGCAGAGACTTAGTGG + Intergenic
1018778034 6:167036409-167036431 AACTAGGAGCAGAGGCCCTGGGG + Intronic
1019079885 6:169423279-169423301 CACTCAGAGCAGAGTCTCCGTGG + Intergenic
1019156794 6:170044700-170044722 TACTGTGAGCACAGGCTCTGTGG - Intergenic
1021732146 7:23606343-23606365 CACTATGAGGCCAGGCACAGTGG - Intronic
1022165028 7:27750466-27750488 CTGTATAAGCAGAGGCTTAGAGG + Intronic
1024934501 7:54698824-54698846 CTCTATCAGCAGAGGCTCTCAGG + Intergenic
1026655673 7:72254588-72254610 AACAGTGATCAGAGGCTCAGAGG + Intronic
1026845881 7:73698991-73699013 CACTAAGAGGAAGGGCTCAGAGG - Intronic
1027711003 7:81601327-81601349 TGCTATGTGCAAAGGCTCAGGGG + Intergenic
1028528847 7:91816070-91816092 CAATTTGGACAGAGGCTCAGTGG + Intronic
1030121050 7:106111742-106111764 CGCTCTGCGGAGAGGCTCAGCGG - Intronic
1030747377 7:113183595-113183617 CAGCATGTGCAAAGGCTCAGAGG + Intergenic
1033251486 7:139764269-139764291 AAATATGACCAGAGGCTCACAGG + Intronic
1033633844 7:143189612-143189634 CACTAGCAGCAGAGCATCAGAGG - Intergenic
1035400318 7:158560669-158560691 CACCATGAGCAGGGGCACATGGG + Intronic
1036903840 8:12691338-12691360 CATTCTGACCAGAGGCTCAATGG + Intergenic
1037599623 8:20383020-20383042 CACCAAGTGCAGAGGCTCAAAGG - Intergenic
1037996980 8:23359860-23359882 CAGCATGGGCAGAGGCACAGAGG - Intronic
1038047599 8:23779336-23779358 CACCAAGAGCAGATGCTTAGGGG + Intergenic
1038608190 8:29031977-29031999 CACCATGTGCAAAGGCACAGAGG + Intronic
1039972780 8:42334508-42334530 CACTGTGAGCACAGACTCAGAGG - Intergenic
1040387490 8:46923397-46923419 CAGCAAGTGCAGAGGCTCAGAGG + Intergenic
1040389100 8:46934208-46934230 GACAATGAGCAGAGGGTCAGCGG - Intergenic
1040656720 8:49519112-49519134 CACCCTGCGCAGAGGCCCAGAGG - Intergenic
1040962766 8:53052204-53052226 CACTCTGAGCAGATCTTCAGAGG - Intergenic
1041158184 8:55009464-55009486 GACTAAGAGCAGAGGGGCAGAGG + Intergenic
1041375610 8:57207501-57207523 CACCCTGAGAAAAGGCTCAGGGG - Intergenic
1041376373 8:57211880-57211902 CACCCTGAGAAAAGGCTCAGGGG - Intergenic
1043314538 8:78903874-78903896 CAGTATGAGCACAAGCTGAGAGG - Intergenic
1044445216 8:92267240-92267262 CCCCATGAGCAGAGGCCAAGGGG + Intergenic
1047502553 8:125453500-125453522 CAACCTGAGCAGAAGCTCAGTGG + Intergenic
1047736766 8:127772382-127772404 AACTATGTGCAAAGGCTCAGAGG + Intergenic
1048552778 8:135449134-135449156 AACAATGAGCAGAGGCATAGTGG + Intergenic
1048680293 8:136833645-136833667 TACTCTGAACAGAGGCTCTGAGG + Intergenic
1049624897 8:143615521-143615543 TAGCGTGAGCAGAGGCTCAGAGG - Intronic
1049922570 9:379061-379083 CAGCATGAGCAAAGTCTCAGAGG + Intronic
1050599896 9:7239875-7239897 GACTATTAACAGAGGCTGAGTGG + Intergenic
1050774249 9:9239950-9239972 AACTATGTTCAGAGTCTCAGAGG + Intronic
1050805412 9:9670928-9670950 CACTACGAGTAGAGACTCTGTGG - Intronic
1050949173 9:11566594-11566616 CACCATGACCAGAGGCCCACAGG + Intergenic
1051097064 9:13477917-13477939 CACTGTGAGCAGATCTTCAGAGG - Intergenic
1053481587 9:38420302-38420324 CAGCATGAACTGAGGCTCAGAGG - Intronic
1055275983 9:74616698-74616720 CACAATAAGCAGGGGCTCACAGG + Intronic
1056318402 9:85414045-85414067 CACTGTGGGGAGAGGCACAGGGG + Intergenic
1056456274 9:86764002-86764024 CAGCATGAGCAAAGGCACAGAGG + Intergenic
1057073323 9:92119361-92119383 CACTATGAGGACAGGGTCATGGG - Intergenic
1057199420 9:93132426-93132448 CAGTGGGAGCAAAGGCTCAGAGG - Intronic
1058375228 9:104315141-104315163 CAGTTTGAGCAGAGGCCCAAAGG - Intergenic
1059611489 9:115902137-115902159 TACTGTGAGCAGAGGCCTAGGGG + Intergenic
1060423271 9:123484688-123484710 GAACAGGAGCAGAGGCTCAGGGG - Intronic
1060491859 9:124091057-124091079 TAGCATGTGCAGAGGCTCAGAGG + Intergenic
1061250822 9:129425367-129425389 CCCTGTGAGCAAAGGCCCAGGGG - Intergenic
1061798619 9:133102570-133102592 AGCTATGAGCAGAGGGGCAGTGG + Exonic
1062528874 9:136991106-136991128 CAGCATGTGCAGAGGCCCAGGGG + Intergenic
1185961804 X:4552777-4552799 CTCTATGAGCAGAAGAGCAGAGG - Intergenic
1186798167 X:13066694-13066716 CAGGAAGAGCAGAGGCACAGAGG - Intergenic
1188864675 X:35300281-35300303 CACTACTAGCATAGGCTCACAGG - Intergenic
1190912683 X:54787248-54787270 CAGCATGTGCAGAGGCACAGAGG - Intronic
1194829000 X:98597249-98597271 CCCTCTGATCAGAGGCCCAGAGG - Intergenic
1195524738 X:105873704-105873726 CATTATGAGCAAAGGCTATGAGG - Intronic
1198018233 X:132633137-132633159 CAGCATGAGCAGAGGCACAGAGG + Intronic
1198837914 X:140823855-140823877 CACTCTGAGCAGATCTTCAGAGG - Intergenic
1198979328 X:142377136-142377158 CAGTATGTGCAGAGGCTCTGGGG + Intergenic
1199806855 X:151308636-151308658 TACTATGAGCAAAGACTTAGAGG + Intergenic