ID: 1144645787

View in Genome Browser
Species Human (GRCh38)
Location 17:16972485-16972507
Sequence ACACCTCAATGGAGCCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144645787_1144645797 24 Left 1144645787 17:16972485-16972507 CCTTCAAGGCTCCATTGAGGTGT No data
Right 1144645797 17:16972532-16972554 GACTGTCCCAGCCTGTCAGGTGG No data
1144645787_1144645796 21 Left 1144645787 17:16972485-16972507 CCTTCAAGGCTCCATTGAGGTGT No data
Right 1144645796 17:16972529-16972551 CCTGACTGTCCCAGCCTGTCAGG No data
1144645787_1144645789 -10 Left 1144645787 17:16972485-16972507 CCTTCAAGGCTCCATTGAGGTGT No data
Right 1144645789 17:16972498-16972520 ATTGAGGTGTCACCTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144645787 Original CRISPR ACACCTCAATGGAGCCTTGA AGG (reversed) Intergenic