ID: 1144645789

View in Genome Browser
Species Human (GRCh38)
Location 17:16972498-16972520
Sequence ATTGAGGTGTCACCTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144645782_1144645789 13 Left 1144645782 17:16972462-16972484 CCTGGTCGGCTCCTCCTGCTCTT No data
Right 1144645789 17:16972498-16972520 ATTGAGGTGTCACCTCCTCCAGG No data
1144645784_1144645789 2 Left 1144645784 17:16972473-16972495 CCTCCTGCTCTTCCTTCAAGGCT No data
Right 1144645789 17:16972498-16972520 ATTGAGGTGTCACCTCCTCCAGG No data
1144645785_1144645789 -1 Left 1144645785 17:16972476-16972498 CCTGCTCTTCCTTCAAGGCTCCA No data
Right 1144645789 17:16972498-16972520 ATTGAGGTGTCACCTCCTCCAGG No data
1144645787_1144645789 -10 Left 1144645787 17:16972485-16972507 CCTTCAAGGCTCCATTGAGGTGT No data
Right 1144645789 17:16972498-16972520 ATTGAGGTGTCACCTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144645789 Original CRISPR ATTGAGGTGTCACCTCCTCC AGG Intergenic