ID: 1144645796

View in Genome Browser
Species Human (GRCh38)
Location 17:16972529-16972551
Sequence CCTGACTGTCCCAGCCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144645792_1144645796 -10 Left 1144645792 17:16972516-16972538 CCAGGAAGCCATCCCTGACTGTC No data
Right 1144645796 17:16972529-16972551 CCTGACTGTCCCAGCCTGTCAGG No data
1144645790_1144645796 -4 Left 1144645790 17:16972510-16972532 CCTCCTCCAGGAAGCCATCCCTG No data
Right 1144645796 17:16972529-16972551 CCTGACTGTCCCAGCCTGTCAGG No data
1144645788_1144645796 10 Left 1144645788 17:16972496-16972518 CCATTGAGGTGTCACCTCCTCCA No data
Right 1144645796 17:16972529-16972551 CCTGACTGTCCCAGCCTGTCAGG No data
1144645791_1144645796 -7 Left 1144645791 17:16972513-16972535 CCTCCAGGAAGCCATCCCTGACT No data
Right 1144645796 17:16972529-16972551 CCTGACTGTCCCAGCCTGTCAGG No data
1144645787_1144645796 21 Left 1144645787 17:16972485-16972507 CCTTCAAGGCTCCATTGAGGTGT No data
Right 1144645796 17:16972529-16972551 CCTGACTGTCCCAGCCTGTCAGG No data
1144645785_1144645796 30 Left 1144645785 17:16972476-16972498 CCTGCTCTTCCTTCAAGGCTCCA No data
Right 1144645796 17:16972529-16972551 CCTGACTGTCCCAGCCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144645796 Original CRISPR CCTGACTGTCCCAGCCTGTC AGG Intergenic