ID: 1144646294

View in Genome Browser
Species Human (GRCh38)
Location 17:16976254-16976276
Sequence CTGTTGATCAATATTTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144646289_1144646294 14 Left 1144646289 17:16976217-16976239 CCTTAAGTTAAATTGTTTGAAGA 0: 1
1: 0
2: 3
3: 43
4: 411
Right 1144646294 17:16976254-16976276 CTGTTGATCAATATTTCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144646294 Original CRISPR CTGTTGATCAATATTTCCCA GGG Intergenic
900779919 1:4611476-4611498 CAGCTGATCAGCATTTCCCATGG - Intergenic
905532398 1:38692184-38692206 CTGTTGATGAATATTTGACAGGG - Intergenic
905965263 1:42088167-42088189 CTGTTGATAGATTTTTCCTATGG + Intergenic
906896968 1:49785676-49785698 CTGTTGAAAACTATTTCCAATGG + Intronic
909975169 1:82037253-82037275 CTGTTGATGAGTATTTCAGATGG - Intergenic
910628552 1:89334414-89334436 ATGTTGAACACTAATTCCCAGGG - Intergenic
910810880 1:91234971-91234993 CAGCTGATCAAAATTTCACATGG - Intergenic
911600891 1:99847322-99847344 CTGTTGATCACTGTTCTCCAGGG - Intergenic
912581801 1:110727655-110727677 CTAGTGAGCAACATTTCCCAAGG - Intergenic
913111646 1:115662714-115662736 CTCTTTAACAATATTTCTCATGG - Intronic
916593668 1:166220332-166220354 CAAATGATCAATATTTCCAAGGG - Intergenic
918726604 1:187933491-187933513 CTGATGATCAACATTTAACAGGG + Intergenic
920976639 1:210792037-210792059 CTGCTCATCAATCTTCCCCATGG + Intronic
922964049 1:229673234-229673256 CTGTTGATGAATCTTGTCCATGG - Intergenic
1063228861 10:4043944-4043966 CTGTTGATCACTATGAGCCAGGG + Intergenic
1063282168 10:4642216-4642238 CACTTGATCAGGATTTCCCATGG - Intergenic
1064239210 10:13610064-13610086 CTGCTGATCAATCTTATCCAAGG - Exonic
1066542584 10:36464100-36464122 CTGATGATGAATTTCTCCCATGG - Intergenic
1067696532 10:48539716-48539738 CTGATTATCAATATTTTCTATGG - Intronic
1071025326 10:81106426-81106448 CTTTTCATCACTATTTCTCAGGG - Intergenic
1072858811 10:98980906-98980928 CTATGGCTCAATATTTGCCATGG + Intronic
1073685310 10:105746018-105746040 CTGCTGTTTAAAATTTCCCATGG + Intergenic
1078052350 11:7977256-7977278 CTGTTGTTCATTATTTCCCGTGG - Intronic
1088013776 11:105035284-105035306 CTGGTGAAGAAAATTTCCCATGG - Intergenic
1088230238 11:107666607-107666629 CTGTTGAATAGTATTTACCATGG + Exonic
1091126523 11:133104225-133104247 CTGTTGATGAAGCTTTTCCATGG + Intronic
1091528118 12:1326711-1326733 CTGTTTATGAATAGTTCACAGGG + Intronic
1091937534 12:4445530-4445552 CTGTTCATCACTATGTCCCGGGG - Exonic
1093188628 12:16050152-16050174 TTTTTGATCAACACTTCCCAGGG + Intergenic
1093766343 12:22967684-22967706 CTGTTAAACAATGTTTCCAATGG - Intergenic
1095299505 12:40566479-40566501 CTTCTGAACAAAATTTCCCAAGG + Intronic
1097733410 12:63154271-63154293 TTGTTCATCAATGTTTTCCAAGG + Intergenic
1097986701 12:65790369-65790391 CTGTTAATCAGTATTTTCCTTGG + Intergenic
1098131103 12:67351406-67351428 TTGTAGATCAATATTTCTCAGGG + Intergenic
1099043458 12:77685338-77685360 CTGCTGATCGACATTTCCAATGG + Intergenic
1099201711 12:79685980-79686002 CTGTTTATCACTATTTCCAGAGG - Intronic
1107333764 13:39331171-39331193 CTGTTGATCACCCTTTTCCATGG - Intergenic
1110554380 13:76842215-76842237 GTGTTGATCTTTCTTTCCCATGG - Intergenic
1110564561 13:76945400-76945422 CTGTTGATCACAATATCCCAGGG - Intergenic
1110830745 13:80027809-80027831 ATGTAGTTCATTATTTCCCATGG - Intergenic
1111171379 13:84530508-84530530 CTGTTGATGAATATCTGCTAGGG - Intergenic
1113338249 13:109397389-109397411 CAGGTGACCAATATTTCCCAGGG - Intergenic
1114940646 14:27606264-27606286 CTGTTGATCAATAAGTGGCAAGG - Intergenic
1115772984 14:36685965-36685987 CTTTTGATCAATATTTTAGAGGG + Intronic
1117870459 14:60195181-60195203 CTGATGATCTAGACTTCCCATGG - Intergenic
1119666579 14:76489293-76489315 CTGTTAATTAATGTTGCCCAAGG + Intronic
1121864325 14:97348290-97348312 CTTTTGAAAAATATTTTCCAAGG - Intergenic
1130101386 15:80896945-80896967 CTTTTGAGCACTATGTCCCATGG - Intronic
1130684554 15:86025337-86025359 CAGTAGATCACTATTTCCCAAGG - Intergenic
1132784559 16:1648645-1648667 CTTTTGACCAATGTTTCCCCTGG + Intronic
1133687275 16:8178239-8178261 ATGCTGTTCAATATTTCCTATGG + Intergenic
1137548652 16:49421722-49421744 CTCATGATCCATATTTCTCAAGG - Intergenic
1144646294 17:16976254-16976276 CTGTTGATCAATATTTCCCAGGG + Intergenic
1144930533 17:18855590-18855612 CTGCTGATCACTGTTTCCCAGGG - Intronic
1146840065 17:36145438-36145460 CTGGTGAACAATATTTCACATGG + Intergenic
1147870711 17:43585492-43585514 CTGTTTGTCAACATTTCCCCAGG + Intergenic
1152934500 17:83128150-83128172 GTGTTGATCAGGATTTACCAAGG - Intergenic
1155891978 18:31281465-31281487 CTATTGATCCATATTTATCATGG + Intergenic
1156245440 18:35293493-35293515 CTGGTAATCAATCTTTCCCCTGG - Intergenic
1156427402 18:37029129-37029151 CTGTGGATCCATCTTCCCCAGGG + Intronic
1156428970 18:37049750-37049772 CTGTTATCCAAGATTTCCCAAGG - Intronic
1158927957 18:62289786-62289808 CTATGGATCAATCTTTCTCAAGG - Intronic
1159338078 18:67097490-67097512 CTGTTCAACAATACTTCCTAAGG - Intergenic
1159991949 18:74919265-74919287 TCCTTGACCAATATTTCCCAAGG + Intronic
1165279733 19:34785811-34785833 CATTGGAACAATATTTCCCAGGG + Intergenic
1165279869 19:34786674-34786696 CATTGGAACAATATTTCCCAGGG - Intergenic
1168505639 19:56932402-56932424 CTGTTGATGAAGATGTCACAAGG - Intergenic
926367695 2:12148173-12148195 CAGTTGATGAATGTTTCACAGGG - Intergenic
926398267 2:12468099-12468121 GTGCTCATCAAGATTTCCCAGGG - Intergenic
930011078 2:46939353-46939375 CTGATGACCAACATTTCTCAGGG - Intronic
930933097 2:56913463-56913485 ATGGTGATAAATATTTTCCAGGG + Intergenic
933710806 2:85324484-85324506 CTTTTTATCAAAATTCCCCAAGG + Intronic
935498237 2:103807475-103807497 AAGGTGATCAATATTTACCAAGG + Intergenic
936634828 2:114243953-114243975 CTGTTGTACAATGTTTCTCAAGG + Intergenic
937504699 2:122523751-122523773 TTGTTGATCAATTTTGCACAGGG - Intergenic
938166044 2:129027808-129027830 CTGTCGTTCAATCTTTCCAAGGG - Intergenic
939899281 2:147830549-147830571 TTGTTGCTAAATATTTCTCATGG + Intergenic
941723411 2:168836354-168836376 CTGTGGATCTTTACTTCCCAGGG - Intronic
943135274 2:183902917-183902939 CTGTAAATAAATATTTTCCAGGG - Intergenic
943195978 2:184750431-184750453 TTCCTGATCAATATTTCCAATGG - Intronic
945800552 2:214424041-214424063 CTGATGATCAATATCACCTAAGG + Intronic
1174622490 20:51886636-51886658 CTGTTCATCTATATATCCCCAGG + Intergenic
1179269881 21:39842504-39842526 ATTTTTATCAATATTTCCAAGGG + Intergenic
1179779375 21:43689639-43689661 GTGTTGCTCAATAAGTCCCAGGG + Intronic
1182151832 22:28032990-28033012 TTGTTGAGTAATATTTACCAGGG - Intronic
949149309 3:745575-745597 CTGTGAATCAATATATGCCAGGG + Intergenic
949242352 3:1888022-1888044 CTGTTTGTCCATATTTGCCATGG - Intergenic
950797074 3:15518995-15519017 CTGTTGGAAAATATTTCCAAAGG + Intronic
950950502 3:16993294-16993316 CTGGTGAACTATATTACCCAAGG - Intronic
954629787 3:52041564-52041586 CTGTTTATAAATATCTGCCATGG - Intergenic
955207489 3:56909595-56909617 CTAGTGATCAGTATTTCACAGGG - Intronic
956748607 3:72329133-72329155 CTGTTGACAAATATCCCCCAAGG - Intergenic
960469048 3:118037609-118037631 TTGTTGGTCAAAATTACCCATGG - Intergenic
960797860 3:121507336-121507358 CTGTTGATTAGAATTTACCATGG + Intronic
963565906 3:146930160-146930182 GTGCTGATCAACATTTCCCTTGG + Intergenic
972833739 4:42843508-42843530 CTGGTGATCAATATTGGCTAAGG + Intergenic
974728614 4:65831814-65831836 CTGTTGATTGCTATTTCCTAAGG + Intergenic
975902016 4:79164572-79164594 CTGTTTAGCAGTGTTTCCCAAGG - Intergenic
976031881 4:80765153-80765175 CTGTTGATCTGTCTTTTCCAAGG + Intronic
977346296 4:95820904-95820926 CTCTTGATCATTATTTCTCAAGG - Intergenic
978015599 4:103741681-103741703 CTGTTGATCTATTTTAGCCATGG - Intergenic
978354307 4:107854789-107854811 CTGTTTCTCAATAAATCCCAAGG - Intronic
978559105 4:110012746-110012768 CTGTAGATTAAAATTTCACATGG + Intergenic
981396959 4:144262310-144262332 CTGTTTATTAATATTTTTCAGGG - Intergenic
982029235 4:151282495-151282517 TTGTTGAAAAATATTTTCCATGG - Intronic
982793334 4:159617277-159617299 CTGTTCAACATTTTTTCCCAAGG + Intergenic
982842376 4:160206650-160206672 TTGTTGTTCAATATTTCCTTTGG + Intergenic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
983768928 4:171523565-171523587 CTGTTGCTCTGTTTTTCCCATGG + Intergenic
984750227 4:183265279-183265301 CTGTTTATCGATAATTTCCATGG - Intronic
985614461 5:911077-911099 CTGTTGACCAATGTCCCCCAAGG - Intronic
987979905 5:25069436-25069458 CTGTTATTCAATATTCCTCAAGG - Intergenic
989190122 5:38662360-38662382 CTGTTCAAAAATATTTCTCAGGG + Intergenic
989221013 5:38963931-38963953 CTGTTAAACAGTATTTCCAAAGG + Intronic
989256624 5:39372808-39372830 CTGAAGATCAATTTCTCCCAAGG - Exonic
989268654 5:39506215-39506237 TTGTAGATGAATATTACCCAAGG + Intergenic
990698667 5:58451702-58451724 GTGTTGATAAATCTTTGCCATGG - Intergenic
991321436 5:65377656-65377678 GTGTTGATAAATTTTTTCCAGGG + Intronic
995015284 5:107302626-107302648 CTAATGTTTAATATTTCCCATGG - Intergenic
995692018 5:114837767-114837789 ATTTTGATCAATATTCCACAAGG + Intergenic
996041209 5:118813931-118813953 TTGTTCATCAGTATTTGCCAGGG - Intergenic
1000441037 5:161263539-161263561 CTGTCCATCAATAATTCCAAGGG + Intergenic
1000957364 5:167559010-167559032 GTGTTGATCTATACATCCCAGGG + Intronic
1001916643 5:175566939-175566961 CTGTTGGTTAATTTTTTCCATGG - Intergenic
1001975469 5:175995107-175995129 CTGTGGATCAAAGCTTCCCAAGG + Intronic
1002241965 5:177848663-177848685 CTGTGGATCAAAGCTTCCCAAGG - Intergenic
1004146895 6:13076330-13076352 CAATTGATAATTATTTCCCAGGG + Intronic
1005522068 6:26610422-26610444 GGGATGATCAATGTTTCCCAAGG + Intergenic
1005601526 6:27431155-27431177 CTGTTGTTCCAGATTTCCCTTGG + Intergenic
1006057144 6:31393767-31393789 CTGTTGATCAAGATGTTCCTGGG + Intergenic
1006486898 6:34350143-34350165 TTGTTAATCAAGATTTCCTATGG - Intronic
1008706637 6:54168561-54168583 CTGTTCACCAATAAGTCCCAGGG + Intronic
1011154017 6:84309272-84309294 CTTTTGATCAATATTCTCAAAGG - Intergenic
1014748367 6:125226809-125226831 CTGCTGCCCAATATTTCTCATGG - Intronic
1014862685 6:126488757-126488779 CTGTTAATGAATATTTACCATGG + Intergenic
1015113866 6:129623945-129623967 CTGTTGTTCCATATTTGCCAAGG - Intronic
1017807571 6:157959185-157959207 CTGTTGATTGATATTTCTCTTGG + Intergenic
1020994170 7:15241516-15241538 ATGGTGATCATTATTTCCTAAGG - Intronic
1021925714 7:25531897-25531919 CTATTGTTTAATATTGCCCAGGG - Intergenic
1021965081 7:25909967-25909989 CTGTTGATTATTATTTGCCTAGG - Intergenic
1022116395 7:27264748-27264770 CTGTTTCTCAACATCTCCCAAGG + Intergenic
1023221723 7:37926103-37926125 CTGTGGATGATTAATTCCCAGGG + Intronic
1026418170 7:70204693-70204715 CTGTTTATCATTGTATCCCAAGG + Intronic
1028427177 7:90702667-90702689 CTGTTAACCATTCTTTCCCAAGG + Intronic
1028885674 7:95929968-95929990 CTCTTAAGAAATATTTCCCAAGG + Intronic
1030109907 7:106018214-106018236 ATGTGGATCTTTATTTCCCAGGG - Intronic
1030740379 7:113102328-113102350 CTTTAGCTCAATATTACCCATGG - Intergenic
1031485054 7:122315464-122315486 GTGTTCATTAATATTTTCCAAGG - Intergenic
1039294498 8:36135087-36135109 CTGTTTATAATCATTTCCCATGG - Intergenic
1039653296 8:39368294-39368316 ATTTTAATAAATATTTCCCATGG - Intergenic
1040436088 8:47393138-47393160 CTGTTGACCAGTTTTTCCCCAGG + Intronic
1041620788 8:59965976-59965998 CTGTTCATCTATATTTCACTGGG - Intergenic
1044182221 8:89210221-89210243 CTTTTGATCAACATTTCCCCTGG + Intergenic
1045486647 8:102636689-102636711 CTGTTGATGATTAATGCCCATGG - Intergenic
1045704325 8:104903156-104903178 GAATTGTTCAATATTTCCCAAGG - Intronic
1046534795 8:115495339-115495361 CTGTTGTTCAATTGCTCCCAAGG + Intronic
1046648010 8:116806643-116806665 CTGTGGAGCAATATTGCCCTTGG + Intronic
1047387702 8:124425336-124425358 CTGTTGATCAATATCTTCTATGG + Intergenic
1048744171 8:137594684-137594706 ATGTTGATGACTATTTACCAGGG - Intergenic
1052457904 9:28724348-28724370 TAATTGATCAATATTTCCCTTGG - Intergenic
1055020248 9:71661882-71661904 CTGTTTACCAATATTTCCTAAGG + Intergenic
1056253953 9:84779052-84779074 CTTCTAATCAATATTACCCAAGG - Intronic
1057530492 9:95841319-95841341 CAGTTTAACAATATTTCTCAAGG - Intergenic
1059250413 9:112882998-112883020 CTGTTGATCACTCTTTCCTCAGG - Intronic
1186959968 X:14725271-14725293 CAGTTGAAGAAAATTTCCCAAGG + Intronic
1187545283 X:20245681-20245703 CTGATGATCAAAATTACCTATGG + Intronic
1194419294 X:93652427-93652449 CTGTTTATCTATATGTCCCAGGG - Intergenic
1194806647 X:98337489-98337511 TTTTCGATCTATATTTCCCAAGG + Intergenic
1194885913 X:99316030-99316052 CACTTAATTAATATTTCCCAGGG + Intergenic
1195080890 X:101369183-101369205 TTGTGGATAAATATTTCCCAAGG - Intronic
1198478300 X:137017081-137017103 CTGTTGATCTGTATTTCTAATGG + Intergenic
1199661060 X:150051662-150051684 CTGTTGGCCAACACTTCCCAGGG + Intergenic
1202028209 Y:20547070-20547092 CTTTTGCTCAGTATATCCCAGGG + Intergenic
1202095321 Y:21243506-21243528 CTGCTGAACAAAATCTCCCAAGG + Intergenic