ID: 1144647330

View in Genome Browser
Species Human (GRCh38)
Location 17:16984274-16984296
Sequence TAAGAAGAGCAGATTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144647324_1144647330 27 Left 1144647324 17:16984224-16984246 CCCAGTGAAGGTATTTTTTAGAC No data
Right 1144647330 17:16984274-16984296 TAAGAAGAGCAGATTGGGGTGGG No data
1144647325_1144647330 26 Left 1144647325 17:16984225-16984247 CCAGTGAAGGTATTTTTTAGACG No data
Right 1144647330 17:16984274-16984296 TAAGAAGAGCAGATTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144647330 Original CRISPR TAAGAAGAGCAGATTGGGGT GGG Intergenic
No off target data available for this crispr