ID: 1144649916

View in Genome Browser
Species Human (GRCh38)
Location 17:17000911-17000933
Sequence CCTGCATGGAGCTTACTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144649916_1144649920 -1 Left 1144649916 17:17000911-17000933 CCAGACAGTAAGCTCCATGCAGG No data
Right 1144649920 17:17000933-17000955 GAAGTCTCTCTGTCTTTCCAGGG No data
1144649916_1144649919 -2 Left 1144649916 17:17000911-17000933 CCAGACAGTAAGCTCCATGCAGG No data
Right 1144649919 17:17000932-17000954 GGAAGTCTCTCTGTCTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144649916 Original CRISPR CCTGCATGGAGCTTACTGTC TGG (reversed) Intergenic