ID: 1144649920

View in Genome Browser
Species Human (GRCh38)
Location 17:17000933-17000955
Sequence GAAGTCTCTCTGTCTTTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144649913_1144649920 2 Left 1144649913 17:17000908-17000930 CCCCCAGACAGTAAGCTCCATGC No data
Right 1144649920 17:17000933-17000955 GAAGTCTCTCTGTCTTTCCAGGG No data
1144649912_1144649920 28 Left 1144649912 17:17000882-17000904 CCTGTGGGATGGTGAGGTGGTCT No data
Right 1144649920 17:17000933-17000955 GAAGTCTCTCTGTCTTTCCAGGG No data
1144649915_1144649920 0 Left 1144649915 17:17000910-17000932 CCCAGACAGTAAGCTCCATGCAG No data
Right 1144649920 17:17000933-17000955 GAAGTCTCTCTGTCTTTCCAGGG No data
1144649916_1144649920 -1 Left 1144649916 17:17000911-17000933 CCAGACAGTAAGCTCCATGCAGG No data
Right 1144649920 17:17000933-17000955 GAAGTCTCTCTGTCTTTCCAGGG No data
1144649911_1144649920 29 Left 1144649911 17:17000881-17000903 CCCTGTGGGATGGTGAGGTGGTC No data
Right 1144649920 17:17000933-17000955 GAAGTCTCTCTGTCTTTCCAGGG No data
1144649914_1144649920 1 Left 1144649914 17:17000909-17000931 CCCCAGACAGTAAGCTCCATGCA No data
Right 1144649920 17:17000933-17000955 GAAGTCTCTCTGTCTTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144649920 Original CRISPR GAAGTCTCTCTGTCTTTCCA GGG Intergenic