ID: 1144650522

View in Genome Browser
Species Human (GRCh38)
Location 17:17004267-17004289
Sequence ACCTCCCTCCGCAGACTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144650516_1144650522 -3 Left 1144650516 17:17004247-17004269 CCTCTTCAACCCATTCCTCCACC No data
Right 1144650522 17:17004267-17004289 ACCTCCCTCCGCAGACTGGCCGG No data
1144650515_1144650522 -2 Left 1144650515 17:17004246-17004268 CCCTCTTCAACCCATTCCTCCAC No data
Right 1144650522 17:17004267-17004289 ACCTCCCTCCGCAGACTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144650522 Original CRISPR ACCTCCCTCCGCAGACTGGC CGG Intergenic