ID: 1144652472

View in Genome Browser
Species Human (GRCh38)
Location 17:17015707-17015729
Sequence GACATGTGTATCCTTAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144652472_1144652474 -7 Left 1144652472 17:17015707-17015729 CCTGAGCTAAGGATACACATGTC No data
Right 1144652474 17:17015723-17015745 ACATGTCAGTCATTAGTGAAGGG No data
1144652472_1144652473 -8 Left 1144652472 17:17015707-17015729 CCTGAGCTAAGGATACACATGTC No data
Right 1144652473 17:17015722-17015744 CACATGTCAGTCATTAGTGAAGG No data
1144652472_1144652477 9 Left 1144652472 17:17015707-17015729 CCTGAGCTAAGGATACACATGTC No data
Right 1144652477 17:17015739-17015761 TGAAGGGCCATCCTGCGGCAGGG No data
1144652472_1144652479 11 Left 1144652472 17:17015707-17015729 CCTGAGCTAAGGATACACATGTC No data
Right 1144652479 17:17015741-17015763 AAGGGCCATCCTGCGGCAGGGGG No data
1144652472_1144652475 4 Left 1144652472 17:17015707-17015729 CCTGAGCTAAGGATACACATGTC No data
Right 1144652475 17:17015734-17015756 ATTAGTGAAGGGCCATCCTGCGG No data
1144652472_1144652478 10 Left 1144652472 17:17015707-17015729 CCTGAGCTAAGGATACACATGTC No data
Right 1144652478 17:17015740-17015762 GAAGGGCCATCCTGCGGCAGGGG No data
1144652472_1144652476 8 Left 1144652472 17:17015707-17015729 CCTGAGCTAAGGATACACATGTC No data
Right 1144652476 17:17015738-17015760 GTGAAGGGCCATCCTGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144652472 Original CRISPR GACATGTGTATCCTTAGCTC AGG (reversed) Intergenic
No off target data available for this crispr