ID: 1144652475

View in Genome Browser
Species Human (GRCh38)
Location 17:17015734-17015756
Sequence ATTAGTGAAGGGCCATCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144652472_1144652475 4 Left 1144652472 17:17015707-17015729 CCTGAGCTAAGGATACACATGTC No data
Right 1144652475 17:17015734-17015756 ATTAGTGAAGGGCCATCCTGCGG No data
1144652470_1144652475 9 Left 1144652470 17:17015702-17015724 CCCAGCCTGAGCTAAGGATACAC No data
Right 1144652475 17:17015734-17015756 ATTAGTGAAGGGCCATCCTGCGG No data
1144652471_1144652475 8 Left 1144652471 17:17015703-17015725 CCAGCCTGAGCTAAGGATACACA No data
Right 1144652475 17:17015734-17015756 ATTAGTGAAGGGCCATCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144652475 Original CRISPR ATTAGTGAAGGGCCATCCTG CGG Intergenic
No off target data available for this crispr