ID: 1144656882

View in Genome Browser
Species Human (GRCh38)
Location 17:17042590-17042612
Sequence AGGCCGCGTCCATGGGCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144656876_1144656882 1 Left 1144656876 17:17042566-17042588 CCGCAGCGGGAAGCAGCGGGCCC 0: 2
1: 0
2: 1
3: 14
4: 196
Right 1144656882 17:17042590-17042612 AGGCCGCGTCCATGGGCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 73
1144656870_1144656882 20 Left 1144656870 17:17042547-17042569 CCGGAGCCTGAGAGGCGGGCCGC 0: 1
1: 1
2: 0
3: 16
4: 149
Right 1144656882 17:17042590-17042612 AGGCCGCGTCCATGGGCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 73
1144656872_1144656882 14 Left 1144656872 17:17042553-17042575 CCTGAGAGGCGGGCCGCAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 159
Right 1144656882 17:17042590-17042612 AGGCCGCGTCCATGGGCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144656882 Original CRISPR AGGCCGCGTCCATGGGCCCG CGG Intronic
910941475 1:92539632-92539654 AGACCCCATCCATGGGCCCCAGG + Intronic
1067028643 10:42865885-42865907 AGGGGGCGTCCATGGGGCCTTGG + Intergenic
1071489105 10:86123931-86123953 AGGCCGCCTGCATGGGCCCTTGG - Intronic
1076352242 10:129825254-129825276 AGGCTGCCTCCCTGGGCCGGGGG + Intergenic
1076686062 10:132198998-132199020 AGGCCGAGACCATGGCCCCTCGG - Intronic
1077340255 11:2023252-2023274 AGGCAGCTTCCATGCGGCCGGGG - Intergenic
1079099409 11:17531526-17531548 CGGCCACGTCCATGGTCCTGTGG + Exonic
1080418594 11:32091454-32091476 AGGCCGCGGCCAGGGCCCCGTGG + Intronic
1083264948 11:61542340-61542362 TGGCCCCGGCCATAGGCCCGGGG + Intronic
1202823240 11_KI270721v1_random:78441-78463 AGGCAGCTTCCATGCGGCCGGGG - Intergenic
1097712791 12:62934290-62934312 ACGCCGCGTCCTTGGGCTGGGGG + Intronic
1102247131 12:111362761-111362783 GGGCCATGTCCAGGGGCCCGTGG + Exonic
1104811001 12:131620382-131620404 ACGCGGCTTCCATGGGCCCTGGG + Intergenic
1104837241 12:131799570-131799592 TGGCCGCCTCCATGGACCCTTGG + Exonic
1104943228 12:132404525-132404547 AGGCTGTGTCCATAGGCCCCGGG + Intergenic
1112494630 13:99895391-99895413 CGGCCGCGTCCACGAGCTCGGGG - Exonic
1113480465 13:110616192-110616214 CCGCCGCGTCCCTGGGCCCCAGG - Intronic
1122848460 14:104513564-104513586 AGGCCGGGTGGCTGGGCCCGGGG + Intronic
1124654380 15:31496776-31496798 AGGCTGCTTCCATGGCCCGGTGG + Intronic
1127477330 15:59347087-59347109 AGCACGGGTCCATGGCCCCGGGG - Intronic
1129387190 15:75202484-75202506 AGGGCGCGTCCAGGGCCCCGCGG - Intronic
1129933688 15:79432171-79432193 AGGCCGCGTCCCGGGGCCGCTGG + Intergenic
1132603492 16:784121-784143 AGGCCGGGGCCAGGTGCCCGAGG + Intergenic
1137402872 16:48167469-48167491 AGGCTGCGTCCTTGGGCTGGTGG - Intronic
1139472684 16:67186711-67186733 AGGCAGCCTCCATGGGGCAGTGG - Intronic
1142648986 17:1334184-1334206 AGGCCGGGCGCATTGGCCCGGGG + Intergenic
1142764295 17:2056974-2056996 CGGCCGCGGCCGTGGCCCCGGGG + Exonic
1143496605 17:7316066-7316088 ACTCAGAGTCCATGGGCCCGCGG + Exonic
1144656882 17:17042590-17042612 AGGCCGCGTCCATGGGCCCGCGG + Intronic
1152242502 17:79167809-79167831 AGGCAGCTTCCAGGGTCCCGGGG - Intronic
1152750787 17:82061572-82061594 AGGCCGTGTGCATGGGGCCCTGG + Intronic
1156489047 18:37485649-37485671 AGGGCGCGTCGGCGGGCCCGGGG - Intronic
1160716795 19:580424-580446 TGGCCGTGCCCATGGGCTCGGGG - Exonic
1160974384 19:1785427-1785449 AGGCCATGTCCAAGGCCCCGGGG + Intronic
1161944817 19:7429011-7429033 AGGCCTAGGCCACGGGCCCGAGG + Intronic
1162746567 19:12801924-12801946 CGGCCGGGTCCATGCGCCTGCGG + Intronic
1167620376 19:50556928-50556950 AGGCCGTGGCAATGGGCCGGGGG + Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
933700038 2:85248493-85248515 AGGCTGTTTCCATGGGCCCTGGG + Intronic
934554579 2:95280577-95280599 AGGTCACCTCCATGGGCCCTAGG + Intronic
942346103 2:175004837-175004859 GGGCCGCGTCCCGGGGCTCGGGG - Intronic
947549649 2:231037425-231037447 AGGCCCCGCCCGGGGGCCCGGGG + Intergenic
948468619 2:238163878-238163900 TGGCCGCGCCCCTGGCCCCGGGG + Exonic
1173872099 20:46348567-46348589 AGGCCGCTTCCAAGCGCCCTTGG + Intronic
1180000553 21:44993549-44993571 AGGCTGGGCCCATGGGCCCGGGG - Intergenic
1181082413 22:20424176-20424198 AGGCTGCGGCCAGGGGGCCGCGG - Intergenic
1183201287 22:36387387-36387409 AGGCTGCGTCCCAGGGGCCGCGG + Intronic
1183535292 22:38397868-38397890 AGGGCGCGTCTAAGGGACCGCGG - Intronic
1184411832 22:44330563-44330585 AGGCCGGGTCCATGCCCCCTAGG - Intergenic
1184751900 22:46491078-46491100 TGGCCATGTCCAAGGGCCCGGGG - Intronic
1185133100 22:49051878-49051900 AGGCCGGGGCCAGGGGACCGTGG - Intergenic
953627305 3:44581252-44581274 AGGCCGCGTCCTTGGGCCCACGG - Intronic
960556267 3:119034473-119034495 AGGCCGGGTCGGCGGGCCCGGGG - Intronic
961457877 3:127033241-127033263 AGGCCACGTACATGGACCTGGGG + Intronic
984260880 4:177442517-177442539 ACGAGGCGTCCCTGGGCCCGCGG + Intergenic
986721462 5:10563923-10563945 AGGCCGGCTCCAGGGGTCCGAGG + Intergenic
992636006 5:78726580-78726602 AGGCCCCGTCCTGGGCCCCGTGG - Intronic
1001402141 5:171451761-171451783 AGGCCCCGTCCATGGAACAGCGG - Intronic
1002182067 5:177435875-177435897 AGGCCGCGCCCAGGGTCCCCGGG - Intronic
1002559507 5:180071891-180071913 GGGACGCGCCCATGGGCCCTCGG + Exonic
1015114247 6:129629514-129629536 ATGCCTCGTCTAGGGGCCCGGGG + Exonic
1017738157 6:157381735-157381757 AGCCCGCGTCCCGGGGCGCGGGG - Exonic
1019013570 6:168862765-168862787 TGTCGGCATCCATGGGCCCGTGG + Intergenic
1019158013 6:170051863-170051885 AGGGCGGGTCCAGGGGTCCGAGG - Intergenic
1029680833 7:102107893-102107915 AGGCCGCATCCATCGTCCCTGGG + Intronic
1030983291 7:116210866-116210888 GGGCCAGGTCCCTGGGCCCGGGG - Intronic
1031485328 7:122317023-122317045 AGCCCGCGTGGAAGGGCCCGCGG - Intergenic
1032095956 7:128938631-128938653 AGGCTGCGTCCCTGGGCTCGCGG + Intronic
1034977586 7:155457469-155457491 GCGCCGCGGCCATTGGCCCGAGG + Intergenic
1036679653 8:10862003-10862025 AGCCCTTGTCCATGGGCCCTGGG + Intergenic
1043527026 8:81108380-81108402 AGGCTGCCTCCATGTGCCTGGGG - Intronic
1047739386 8:127794554-127794576 CGGCCGAGCACATGGGCCCGCGG + Intergenic
1049668194 8:143858163-143858185 AGGCCACGTCCACGGGCACGCGG + Exonic
1049668610 8:143859762-143859784 AGGCCACGTCCACGGGCACGCGG + Exonic
1049669025 8:143861364-143861386 AGGCCACGTCCACGGGCACGCGG + Exonic
1049669440 8:143862966-143862988 AGGCCACGTCCACGGGCACGCGG + Exonic
1049669850 8:143864559-143864581 AGGCCACGTCCACGGGCACGCGG + Exonic
1049670267 8:143866167-143866189 AGGCCACGTCCACGGGCACGCGG + Exonic
1049670623 8:143868141-143868163 AGGCCACGTCCACGGGCACGCGG + Exonic
1049671264 8:143871024-143871046 AGGCCACGTCCACGGGCACGCGG + Exonic
1049680668 8:143916587-143916609 GGGCCTCGTCCAGGGGCACGCGG + Exonic
1049681234 8:143919356-143919378 AGGCCACGTCCACAGGCACGCGG + Exonic
1049681645 8:143921333-143921355 AGGCCACGTCCACGGGCACGCGG + Exonic
1057739157 9:97697031-97697053 AAGCCGAGTCCCGGGGCCCGGGG - Intronic
1059424829 9:114214417-114214439 AGGCCGCATGCACGGGCCCAAGG - Intronic
1062533371 9:137011222-137011244 AGGCCATCTCCATGAGCCCGTGG + Exonic
1192510757 X:71719235-71719257 AGGCCGTGGCCCTGGCCCCGTGG - Intergenic
1192515940 X:71762318-71762340 AGGCCGTGGCCCTGGCCCCGTGG + Intergenic
1195637193 X:107131626-107131648 CGGCCGCGGCCTTGGTCCCGCGG - Intronic