ID: 1144658082

View in Genome Browser
Species Human (GRCh38)
Location 17:17050814-17050836
Sequence GTCCTGTGGGGAGCCGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144658074_1144658082 -7 Left 1144658074 17:17050798-17050820 CCAGGGCCTCAGGCCTGTCCTGT 0: 1
1: 0
2: 2
3: 54
4: 494
Right 1144658082 17:17050814-17050836 GTCCTGTGGGGAGCCGGTGAGGG 0: 1
1: 0
2: 2
3: 20
4: 175
1144658073_1144658082 -2 Left 1144658073 17:17050793-17050815 CCTTGCCAGGGCCTCAGGCCTGT 0: 1
1: 0
2: 5
3: 54
4: 548
Right 1144658082 17:17050814-17050836 GTCCTGTGGGGAGCCGGTGAGGG 0: 1
1: 0
2: 2
3: 20
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144658082 Original CRISPR GTCCTGTGGGGAGCCGGTGA GGG Intronic
900095086 1:936974-936996 GTCCTGTGGGGTGCACGTGATGG + Intronic
900422106 1:2560144-2560166 GCCCAGTGGGGAACAGGTGATGG + Intronic
900662230 1:3790535-3790557 GTGCTGTGGTGAGCCGAGGATGG - Intronic
901678354 1:10899638-10899660 GTCCTGTGGGGGGTCAGTGGGGG + Intergenic
902026873 1:13390415-13390437 GGCCTCTGGGGAGCAGGAGAGGG - Exonic
902130008 1:14251957-14251979 ATCTTGTGGGGAGCTTGTGAAGG + Intergenic
902273953 1:15325949-15325971 TTCCTGTGGGGAGCCCCTGATGG + Intronic
902604491 1:17561315-17561337 GTTCTGTGGGCAGCTGGAGATGG + Intronic
902835662 1:19045210-19045232 GTGCTGAGGGGTGGCGGTGATGG - Intergenic
903377498 1:22876079-22876101 GTGCAGTGGGAAGCCGCTGAGGG + Intronic
904433530 1:30479733-30479755 GGCCTGTAGGGAGCTGGTGTAGG - Intergenic
904840282 1:33368060-33368082 ATTCTGTGGGCAGCCGGGGAAGG - Intronic
905518772 1:38581507-38581529 GTCCTGTGGGAACCTGGTGTGGG - Intergenic
906381009 1:45332178-45332200 GCCCTGTGGAGAGCCTGTGCCGG - Exonic
906694984 1:47817718-47817740 GTCCTGCGAGGAGCCCGTGAAGG - Intronic
907523910 1:55042665-55042687 AGGCTGTGGGGAGCCAGTGAAGG + Intronic
912257385 1:108074373-108074395 GCCCTGTGGAGAGGAGGTGAGGG - Intergenic
915566353 1:156715562-156715584 GTTCTGGAGGGAGCAGGTGACGG - Intergenic
922648865 1:227319011-227319033 GGCCGGTGGGGAGCAGGTAAGGG - Intergenic
1063583879 10:7333758-7333780 GCCCTGTGGGGAGCTGGGGTGGG - Intronic
1063974504 10:11404726-11404748 GTGCTGTCAGGAGCCTGTGATGG - Intergenic
1067144842 10:43687585-43687607 GTGCTGTGGAGACCCGGAGATGG + Intergenic
1070638095 10:78145388-78145410 GTCCTGAGGGGTGGTGGTGATGG + Intergenic
1070644922 10:78195222-78195244 TCCCTGTGGGGGGCCGGGGATGG + Intergenic
1070777498 10:79118407-79118429 GTCCTGTGGGAAGCGGGAGGAGG + Intronic
1070788197 10:79174447-79174469 GGGCAGTGGGGAGCCGGTGAGGG + Intronic
1070829433 10:79409539-79409561 GGGCTCTGGGGAGCAGGTGAAGG + Intronic
1071568701 10:86684803-86684825 GCCCTGTCGGGGGCCTGTGAGGG - Intronic
1076312322 10:129517327-129517349 GTGCTCTGGGGAGCCTGTGCTGG - Intronic
1076405874 10:130212291-130212313 CTCCTGGGGGGAGCCACTGAGGG + Intergenic
1076530711 10:131142643-131142665 GACCTGAGGGCAGCCTGTGATGG - Intronic
1076737193 10:132464189-132464211 GGCGTGTGGGTAGCCAGTGAGGG - Intergenic
1081806225 11:45892247-45892269 GTCCTCTGGGAAGACGGTGCTGG - Intronic
1083310287 11:61780416-61780438 GTGCTGTGGGGATCCAGGGAGGG + Intronic
1083802074 11:65052662-65052684 GGGTTGTGGGAAGCCGGTGAAGG - Intronic
1084312995 11:68327337-68327359 GTCATGAGGGGACCCAGTGAAGG + Intronic
1085203692 11:74717640-74717662 ATCCTGTGGGGTGGCGGAGAGGG - Intronic
1085455026 11:76660746-76660768 GCCCTGTGGGGAGCCGGATGAGG + Exonic
1085769507 11:79312137-79312159 GTCCTGTGGGGAGCTGTAGATGG - Intronic
1090276179 11:125421361-125421383 GTCATGTGAGGAGCGGCTGAGGG + Intronic
1092164218 12:6333185-6333207 GTCCTGTGGGGTGGGGGTGCAGG - Intronic
1092229750 12:6769901-6769923 CTCCTGTGGGGACCAGGAGAGGG - Exonic
1096489818 12:52007301-52007323 GCCCTGTAGGGAGTCGGAGAGGG - Intronic
1096501163 12:52064490-52064512 GGCCTGTGGGGAGACCTTGAAGG - Intergenic
1097899605 12:64859515-64859537 GGCCTGTGAGGAGGCAGTGAAGG + Intronic
1102877392 12:116458821-116458843 GGCCTGTGGGCAGGCGGTGCCGG + Intergenic
1103537328 12:121641858-121641880 CTCCTGTTGGGAGGCGGTGGGGG + Exonic
1104271085 12:127282829-127282851 GCACAGTGGGGAGCAGGTGAGGG - Intergenic
1104470946 12:129029162-129029184 GTCCTTTGGGGAGCTGTGGAAGG + Intergenic
1107873553 13:44768972-44768994 TACCTGTGGGAAGCCAGTGAAGG + Intergenic
1107919458 13:45189044-45189066 GTGGGGTGGGGAGCCGGGGAGGG - Intronic
1112505196 13:99970986-99971008 GTGCTGGGGGGAGCCGGTGCCGG + Exonic
1114037187 14:18640581-18640603 GGCCTGTGGGGAGCTAGGGAAGG + Intergenic
1114121454 14:19674462-19674484 GGCCTGTGGGGAGCTAGGGAAGG - Intergenic
1114171098 14:20273211-20273233 GTCCTGGGGGGACCCTGTGTGGG - Intronic
1114540164 14:23449443-23449465 GACCTGGGGGGAGACTGTGAAGG - Intergenic
1123173832 14:106399255-106399277 AGCCTGTGGGGAGCCTGTGGAGG + Intergenic
1123182085 14:106480529-106480551 AGCCTGTGGGGAGCCTGTGGAGG + Intergenic
1202944820 14_KI270726v1_random:16201-16223 AGCCTGTGGGGAGCCTGTGGAGG - Intergenic
1124892116 15:33743063-33743085 TTCCTGTGGGCAGCCAGTTAAGG + Intronic
1128495461 15:68195936-68195958 GTCCTGGGGGGAGTCTGGGAGGG + Intronic
1128496198 15:68200039-68200061 GTCCTGTGGGTTGGCGGGGAGGG - Intronic
1129265850 15:74392724-74392746 GTGCTGTGGGGAGCGGGAGCTGG - Intergenic
1129645041 15:77421190-77421212 TTCCTGTGGGGGGGTGGTGATGG + Intronic
1132250503 15:100332442-100332464 ATCCTCTGGGGAGCAGGTGGGGG - Intronic
1132316812 15:100896027-100896049 TACCTCTGTGGAGCCGGTGAAGG - Exonic
1132674782 16:1117108-1117130 GGCCTGTGGGGACAGGGTGAGGG - Intergenic
1134062351 16:11206723-11206745 GGACTGTGGGGAGCAGGAGAGGG - Intergenic
1134252610 16:12585064-12585086 GTATTGTGGGAAGTCGGTGAAGG - Intergenic
1135296472 16:21283751-21283773 GGAGTGTGGGGAGCCGGGGACGG - Intronic
1136005291 16:27325042-27325064 GGGCAGTGGGGAGCCAGTGAAGG - Intronic
1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG + Intergenic
1137055933 16:35746711-35746733 GTCATGTGGGAAGCGGGTGGCGG - Intergenic
1139827153 16:69766357-69766379 GTCCTGTGTGGAGAAAGTGAAGG - Intronic
1142020784 16:87780899-87780921 AGCCTGTGGGGAGAGGGTGAAGG - Intergenic
1144658082 17:17050814-17050836 GTCCTGTGGGGAGCCGGTGAGGG + Intronic
1148130185 17:45257643-45257665 GTCCTGGGAGTAGCCGGTGGGGG - Intronic
1151509482 17:74549541-74549563 GAGCTGTGGGGACACGGTGATGG + Intergenic
1152198948 17:78934114-78934136 TTCCTGGGGAGAGCCAGTGATGG - Intergenic
1152337886 17:79708273-79708295 GTCCTGCGGGAGGCCCGTGATGG - Intergenic
1153986108 18:10352266-10352288 GTCCTATGGGCAGTGGGTGAGGG + Intergenic
1155427748 18:25723989-25724011 GGGCTGTGGGGAGCCGGTGATGG + Intergenic
1160717256 19:582008-582030 GGCCTGTGTGGGGCCTGTGATGG + Intronic
1160766262 19:809643-809665 GTACTGTGGGGGGCCGGGCAGGG + Intronic
1160961066 19:1721038-1721060 GACCTTTGGGGAGAGGGTGAGGG - Intergenic
1161199495 19:3006507-3006529 ATGCTGTGTGGAGCCGCTGATGG + Exonic
1161316323 19:3619240-3619262 GAACTGTGGGGAGCAGGGGAAGG + Exonic
1161383145 19:3977101-3977123 GTCCTGATGGGAGCAGGTGATGG - Intronic
1161863090 19:6813270-6813292 GTCCTGTGGGGAGCCCCAGGTGG - Intronic
1162856680 19:13473938-13473960 GTGCAGTGGGGAGCAAGTGAGGG - Intronic
1164617621 19:29676276-29676298 GGCCTGTGGGCACCCTGTGAGGG + Intergenic
1166719201 19:44987832-44987854 GTGCTGCGGGGAGTGGGTGAAGG - Intronic
1167109378 19:47449981-47450003 GTAATGGGGGGAGCCGGGGAGGG + Intronic
1168705799 19:58469708-58469730 GTCCTGTGAGGAGGAGGTGCAGG - Exonic
925383323 2:3443935-3443957 GTCCTGTGGGGAGGGCGTGGAGG - Intronic
925447805 2:3942846-3942868 GCCATCTGGGGACCCGGTGAAGG - Intergenic
927124015 2:19996692-19996714 GGGCTGAGGGGAGCGGGTGATGG + Intronic
928453426 2:31398740-31398762 GTCCTTTGGGGAGCCTGGGAGGG - Intronic
929994624 2:46817530-46817552 GACCTGTTGGGTGTCGGTGAGGG + Intronic
932431098 2:71674042-71674064 GTCCTGTGGGAAGACTGGGAAGG - Intronic
934559386 2:95304804-95304826 GGCCTGTGGGGAGCCAGGGAGGG - Intronic
937033535 2:118761827-118761849 GTTCTGTGGGAAGCTGGGGAGGG + Intergenic
941069943 2:160944589-160944611 GTCCAGTGTGGAGACAGTGAGGG - Intergenic
941611034 2:167662668-167662690 GTCATATGGGGAGCCATTGAAGG - Intergenic
942803622 2:179903609-179903631 GTCCTGAGGTGAGGCTGTGAAGG + Intergenic
943353060 2:186818102-186818124 GGCCTGTGGTGGGCGGGTGAGGG + Intergenic
946415393 2:219537542-219537564 GTCCTGTGGGCAGCTGGGCATGG + Intronic
948772346 2:240258156-240258178 GGCCTGTGAGGAGACGGTCAGGG - Intergenic
948900338 2:240953545-240953567 GGCCTGTGGGGAGCCCTTGCCGG + Intronic
948999622 2:241605536-241605558 CACCTGTGGGGAGCAGGTGGTGG + Intronic
1173565296 20:44034293-44034315 GTCCTGTGGGGTGCCAGAGAAGG - Intronic
1174398053 20:50260076-50260098 GTCCTGTGAGGGGCTGGTGCTGG + Intergenic
1175369874 20:58481073-58481095 GTGCTTGGAGGAGCCGGTGAGGG + Intronic
1175374571 20:58515354-58515376 GTGTGGTGGGGAGCGGGTGACGG - Intergenic
1175951866 20:62587877-62587899 GGCCTGTGGGGTGCCGGGGTGGG + Intergenic
1180165541 21:46023988-46024010 GTCTTGTGGGCAGGCTGTGAGGG + Intergenic
1180461310 22:15567629-15567651 GGCCTGTGGGGAGCTAGGGAAGG + Intergenic
1181570994 22:23767794-23767816 GCCCTGTGGGGAGGGGGTTAGGG - Intronic
1181636558 22:24177416-24177438 GACCTGGGGGGAGCGGGTGGGGG + Intronic
1181808562 22:25390188-25390210 GTCCTGAGGGGACCCAGTGAAGG - Intronic
1183459336 22:37940568-37940590 TTCCTGTGTGGAGCCTGGGAGGG - Intronic
1184175352 22:42785838-42785860 GCTCTGGGGGGAGCAGGTGAAGG + Intergenic
1184324354 22:43771777-43771799 AGGCTGTAGGGAGCCGGTGAAGG - Intronic
1184491315 22:44810791-44810813 TTCCCGTGGGGAGCCGTGGAGGG + Intronic
1184676464 22:46045734-46045756 GTTCCTTGGGGAGCAGGTGAGGG + Intergenic
952903089 3:38122269-38122291 CTCCTGTGGGGAGCATGTGGGGG - Exonic
953246550 3:41199240-41199262 GGCCTGAGGGCAGCCCGTGAGGG - Intronic
953376244 3:42430871-42430893 GTCCTGTGGAGGGCAGGAGATGG + Intergenic
953846450 3:46430887-46430909 GGCCTGTTGGGAGGCGGTGCTGG - Intergenic
961171557 3:124801152-124801174 GTGCTGTGGGAAGCCCATGACGG + Intronic
962318578 3:134373710-134373732 CGCCTGGGGCGAGCCGGTGAGGG + Intronic
963870438 3:150409284-150409306 GTCCTGTCGGAAACCGGGGAGGG - Exonic
969590373 4:8118576-8118598 GTTCTGTGGGGAGCCATGGAAGG - Intronic
969591837 4:8126504-8126526 GGCCTGTGGGGTGAAGGTGATGG - Intronic
974056207 4:56985391-56985413 GTGCTGTGGCGAGGCGGGGATGG + Intronic
980890732 4:138812245-138812267 GGGCTGTGGGGAGCAGGAGAGGG + Intergenic
981932805 4:150208965-150208987 GTTCTGTGGTGGGCCTGTGATGG + Intronic
985576872 5:677657-677679 GTTCTGTGGGGAGCGGGCCATGG - Intronic
985623044 5:965815-965837 GTCCTGTGGGCAGGAGGGGAGGG + Intergenic
997198410 5:131994882-131994904 GTCCTCTTGGTAGTCGGTGAGGG - Intronic
999609087 5:153350150-153350172 GTCATTTGCGGAGCGGGTGATGG + Intergenic
1000681836 5:164194761-164194783 GTCCTGTGGAGATCCTCTGATGG - Intergenic
1001562797 5:172680377-172680399 CTCCTGTGTGGAGCCGCTGGGGG + Intronic
1001651326 5:173318197-173318219 GACCTGTGGGGAGGAGGTGAAGG - Exonic
1001917459 5:175573859-175573881 GTGCTGTGGGGGGCAGGAGAGGG - Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002565743 5:180112312-180112334 GGCCTGTGGGTAGCATGTGACGG + Intronic
1002918571 6:1548682-1548704 GTCCTGTGGGGACCTGGGTAAGG + Intergenic
1007953709 6:45897152-45897174 GTCCTCTGGGGACCCTGAGAGGG - Intergenic
1008052856 6:46917667-46917689 GGCCTGTGGGGGGCGGGTGAGGG - Intronic
1008150402 6:47943471-47943493 GTGCTGTGGGGAGGCAGTGAAGG + Intronic
1010705971 6:79111174-79111196 GTCCAGTGGGGAGCCCCTGAAGG + Intergenic
1012506183 6:99948964-99948986 CTCCTGTGGGGAGCCGGGGGTGG + Intronic
1013318190 6:108961152-108961174 GTTCTGTTGGGAGGCGGTGTGGG + Intronic
1017090871 6:150757853-150757875 GGCCTGTTGGGAGGGGGTGAGGG - Intronic
1018474770 6:164129826-164129848 GTCCTTTGGGGAGAAGGCGAAGG + Intergenic
1018977909 6:168579604-168579626 GTCCTGAGGGGAGCTGGTGAGGG + Intronic
1019129102 6:169860467-169860489 TTCCTGTGGGGATCTCGTGACGG - Intergenic
1019153351 6:170023444-170023466 GGCCTGAGGAGAGCCGGAGAAGG - Intergenic
1019538417 7:1540596-1540618 ATCCTGCGGGGAGCAGGTGGCGG - Exonic
1019552493 7:1610162-1610184 GTCATGCTGGGAGCCGGGGAAGG - Intergenic
1021964995 7:25908796-25908818 GTCTTGCGGGGAGCTGGTGGTGG - Intergenic
1022486884 7:30785973-30785995 CACCTGTGGGGAGCTGGCGATGG - Exonic
1025210688 7:57018183-57018205 GTCCTTTGGGGACCCGTTGGGGG + Intergenic
1025661268 7:63558664-63558686 GTCCTTTGGGGACCCGTTGGGGG - Intergenic
1026824561 7:73573372-73573394 GTCCTCTGGGGTGGCTGTGAAGG + Exonic
1026988691 7:74570915-74570937 GAGCTGTGGGGAGCTGGTGGCGG - Intronic
1029515143 7:101019092-101019114 GTCCTGACTGGAGCCGGGGAGGG - Intergenic
1033235861 7:139637268-139637290 GTCCAGTGGGGAGCCCCTGAAGG - Intronic
1033712853 7:143966774-143966796 TTCCTGTGCGGAGCCTGTTATGG + Intergenic
1033737633 7:144239104-144239126 ATGCTTTGGGGAGCTGGTGAGGG + Intergenic
1033745423 7:144311853-144311875 ATGCTTTGGGGAGCTGGTGAGGG - Intergenic
1035094848 7:156345915-156345937 CTCCTCAGGGGAGCTGGTGAAGG - Intergenic
1035733022 8:1865844-1865866 GTCCTGTGGGGAGCTGTGCAAGG - Intronic
1037473891 8:19237609-19237631 GCGCTGTGCGGAGCCGGTGGTGG + Intergenic
1038617173 8:29105463-29105485 GTCCTGTGTGAAGCCAGTGGGGG + Intronic
1039567973 8:38564739-38564761 GGCCGGTGGGGGGCCGGTGGGGG - Intergenic
1049238003 8:141522306-141522328 GACCTCTGGGGAGCTGCTGAGGG + Intergenic
1049261254 8:141640423-141640445 GCTCTGTGGGGCGCCGGTGTGGG + Intergenic
1051338939 9:16093328-16093350 GGCCTGTGGGAAGCCCCTGAAGG - Intergenic
1052932182 9:34064776-34064798 GTCCAGTGGGGAGGAGGAGAAGG - Intergenic
1054750415 9:68899209-68899231 GTCCTGAGACGAGCAGGTGAGGG - Intronic
1056499788 9:87197479-87197501 GTCCTGCTAGGAGCCGGGGAAGG + Intergenic
1057110890 9:92469758-92469780 GTGCTGAGGGGAGGCGGTGGCGG + Intronic
1057361094 9:94374506-94374528 GGCCTGTGGGGAGGCGGGGCGGG + Intergenic
1060533656 9:124365316-124365338 GTCTCGTGGGGTGCAGGTGATGG + Intronic
1060543999 9:124450057-124450079 GTCCTGTAGGGAGCCGGCTCAGG + Intergenic
1060963557 9:127698879-127698901 GTCTTGTGGGAAGCCGCTGCTGG - Intronic
1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG + Exonic
1062088497 9:134661419-134661441 GTCCTGTGGGCAGATGCTGACGG + Intronic
1062139586 9:134948410-134948432 TGCCTGTGGGTGGCCGGTGATGG - Intergenic
1062559724 9:137136136-137136158 GATCTGTGGGGATCCTGTGATGG + Intergenic
1203613403 Un_KI270749v1:28749-28771 GTCCTGTGGGGGGGGGGTGGTGG + Intergenic
1192337676 X:70235632-70235654 GTAATGTGGAGAGCTGGTGATGG + Intronic
1197148757 X:123196586-123196608 GTCCTGTGGACAGCCACTGATGG - Intronic
1199771187 X:150976249-150976271 GTCTGGTGGGGAGGGGGTGAGGG + Intergenic
1200062486 X:153489791-153489813 GGCCCGTGGGGGGCCAGTGAGGG - Intronic
1200071489 X:153531500-153531522 GGTCTGTAGGGAGCAGGTGACGG + Intronic