ID: 1144658228

View in Genome Browser
Species Human (GRCh38)
Location 17:17051670-17051692
Sequence AGAGCTCTGGGTAGGGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 322}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144658228_1144658238 2 Left 1144658228 17:17051670-17051692 CCCCATGCCCTACCCAGAGCTCT 0: 1
1: 0
2: 0
3: 31
4: 322
Right 1144658238 17:17051695-17051717 AGGCATTGTCACTTCCGTTGGGG 0: 1
1: 0
2: 0
3: 9
4: 144
1144658228_1144658239 3 Left 1144658228 17:17051670-17051692 CCCCATGCCCTACCCAGAGCTCT 0: 1
1: 0
2: 0
3: 31
4: 322
Right 1144658239 17:17051696-17051718 GGCATTGTCACTTCCGTTGGGGG 0: 1
1: 0
2: 0
3: 5
4: 57
1144658228_1144658241 17 Left 1144658228 17:17051670-17051692 CCCCATGCCCTACCCAGAGCTCT 0: 1
1: 0
2: 0
3: 31
4: 322
Right 1144658241 17:17051710-17051732 CGTTGGGGGCAAGAGCACCTAGG 0: 1
1: 0
2: 0
3: 7
4: 101
1144658228_1144658243 19 Left 1144658228 17:17051670-17051692 CCCCATGCCCTACCCAGAGCTCT 0: 1
1: 0
2: 0
3: 31
4: 322
Right 1144658243 17:17051712-17051734 TTGGGGGCAAGAGCACCTAGGGG 0: 1
1: 0
2: 1
3: 10
4: 139
1144658228_1144658244 20 Left 1144658228 17:17051670-17051692 CCCCATGCCCTACCCAGAGCTCT 0: 1
1: 0
2: 0
3: 31
4: 322
Right 1144658244 17:17051713-17051735 TGGGGGCAAGAGCACCTAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 164
1144658228_1144658237 1 Left 1144658228 17:17051670-17051692 CCCCATGCCCTACCCAGAGCTCT 0: 1
1: 0
2: 0
3: 31
4: 322
Right 1144658237 17:17051694-17051716 AAGGCATTGTCACTTCCGTTGGG 0: 1
1: 0
2: 1
3: 10
4: 73
1144658228_1144658236 0 Left 1144658228 17:17051670-17051692 CCCCATGCCCTACCCAGAGCTCT 0: 1
1: 0
2: 0
3: 31
4: 322
Right 1144658236 17:17051693-17051715 CAAGGCATTGTCACTTCCGTTGG 0: 1
1: 0
2: 0
3: 6
4: 74
1144658228_1144658242 18 Left 1144658228 17:17051670-17051692 CCCCATGCCCTACCCAGAGCTCT 0: 1
1: 0
2: 0
3: 31
4: 322
Right 1144658242 17:17051711-17051733 GTTGGGGGCAAGAGCACCTAGGG 0: 1
1: 0
2: 0
3: 6
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144658228 Original CRISPR AGAGCTCTGGGTAGGGCATG GGG (reversed) Intronic
900353420 1:2248121-2248143 AGGGCTCTGGGGAAGGAATGTGG - Intronic
900365970 1:2312112-2312134 TGAGCTCAGGGAAGGGGATGGGG + Intergenic
900780547 1:4614892-4614914 AGAGCAATGGGGAGGGCAGGAGG + Intergenic
900972892 1:6001230-6001252 AGGGCTCAGGGTAGGGCCTGGGG - Intronic
901023441 1:6266822-6266844 AGAGCTGTAGGGTGGGCATGGGG + Intronic
902263738 1:15246859-15246881 AGAGATTTGGGTAGGGCAGGGGG + Intergenic
902529497 1:17081498-17081520 AGGGCACTGGGTAAGGAATGTGG + Intronic
904336855 1:29803502-29803524 AGAGCTGTGGGTGGGTCACGTGG - Intergenic
905389962 1:37630009-37630031 AGTCTTCTGGGTAGGGCAGGAGG - Intronic
907423307 1:54362210-54362232 GGAGCTCTGGGTCTAGCATGAGG - Intronic
907724968 1:57011244-57011266 AGAGCTCTGTCTAGGGGCTGGGG + Exonic
910012156 1:82478696-82478718 AGAGTTCTGGGAAGAGCAAGAGG + Intergenic
911337583 1:96599502-96599524 ATATCTCAGGGTCGGGCATGGGG + Intergenic
912721469 1:112024101-112024123 AGAGTTGTGGAAAGGGCATGGGG - Intergenic
915316161 1:155030236-155030258 AGGGCTCTGGGAAGGGGAGGTGG + Exonic
915355125 1:155251211-155251233 AGAGCTCTGTCTAGCACATGGGG - Intronic
915359917 1:155279636-155279658 AGAAGGCTGGGGAGGGCATGAGG + Intronic
915669429 1:157476445-157476467 GGAGCTGGGGATAGGGCATGGGG + Intergenic
916077322 1:161209407-161209429 AGAGGTCTGGGCAGAGCCTGGGG - Intronic
916589950 1:166180771-166180793 AGGGCCCTGGGTGGGGCAGGTGG - Intergenic
916968909 1:169987464-169987486 AGATGTTTGGGTAGGGGATGGGG - Intronic
917716731 1:177745814-177745836 AGTGATCTGGCTAGGGCATAGGG - Intergenic
920375145 1:205504390-205504412 AGAGCCTTGGCTAGGGGATGAGG - Intergenic
920495003 1:206448259-206448281 ACAGCTGTGGGGAGGCCATGTGG - Intronic
921054153 1:211531551-211531573 AAGGCTCTGTGTTGGGCATGGGG + Intergenic
923847456 1:237751121-237751143 AAAGCTATGGTTAGGTCATGAGG - Intronic
1064292760 10:14050830-14050852 GGTGCACTGGGCAGGGCATGCGG - Intronic
1065042578 10:21712597-21712619 AGAGCTCTTGGGAGGGCAAGAGG - Intronic
1065198799 10:23293911-23293933 GTAGCTCTGGGTTGGGCCTGAGG - Intronic
1065832771 10:29630179-29630201 AGAGCTCCGGGTGGGTCCTGTGG - Intronic
1065979229 10:30875133-30875155 TGAGCTCTGGGTAGGGCCAAGGG + Intronic
1067476792 10:46572733-46572755 TGCCCTCTGGGTAGGGCCTGTGG + Intergenic
1067617946 10:47769047-47769069 TGCCCTCTGGGTAGGGCCTGTGG - Intergenic
1068454729 10:57239299-57239321 AGAGATATGGGTAGGGCCAGTGG + Intergenic
1070889388 10:79930746-79930768 GGAGCTCTGGGCAGGGCTGGAGG - Intergenic
1070959795 10:80490609-80490631 TGAGCTCTGGGTAGGGGATCTGG + Intronic
1071130791 10:82391209-82391231 AGAGCCCTGGTTTGGGTATGAGG + Intronic
1074250018 10:111735668-111735690 AGAGCTCCAGGTAGGGGAAGTGG + Intergenic
1074456638 10:113601256-113601278 AAAGCTCTGGGTAGGGCCAGAGG - Intronic
1075499632 10:122961149-122961171 AGAGCCCTGGGCAATGCATGAGG - Intronic
1075671214 10:124265248-124265270 ACAGCCCTGGGTAGGGCGAGTGG - Intergenic
1076284404 10:129278820-129278842 AAGGCTCTGGGGAGGGCAGGAGG + Intergenic
1076900309 10:133334718-133334740 CGAGGGCTGGGTAGGGGATGGGG + Intronic
1077507136 11:2935027-2935049 TGAGCCCTGTGCAGGGCATGGGG - Intergenic
1077560602 11:3257928-3257950 ATGGCTCTGGGTAGAGCATGAGG + Intergenic
1077566497 11:3303756-3303778 ATGGCTCTGGGTAGAGCATGAGG + Intergenic
1077573069 11:3355721-3355743 AGAGACCTGGGAAGGGCAAGTGG + Intronic
1078766882 11:14306736-14306758 AAAGCTCAGGGTAGGGAATGGGG - Intronic
1079558810 11:21795163-21795185 AGAGCTGGGGGAAGGGGATGGGG - Intergenic
1080646971 11:34194523-34194545 AGAGCTCTGGTGAGGGTATCAGG + Intronic
1081607303 11:44535453-44535475 AGAAGTCTGGGCAGGGCAGGAGG + Intergenic
1081646908 11:44796462-44796484 GGAGCTCAGGGTCGGTCATGGGG + Intronic
1083266345 11:61548579-61548601 AGAGCGCTGGGGTGGGCCTGGGG + Intronic
1083427304 11:62594968-62594990 AAAGATCTGGGTATGGGATGGGG - Exonic
1083618374 11:64037089-64037111 AGAGCTCTGGCTTGGGCCTCGGG - Intronic
1084266498 11:68008031-68008053 AGCCCTCTGGGTAGGGCACCAGG - Intergenic
1084569629 11:69951568-69951590 TGAGCTCTGGGCAGGTCAAGGGG + Intergenic
1085072995 11:73564995-73565017 AGAGCTCTTGATAGGGAATCAGG - Intronic
1087868804 11:103266285-103266307 ACAGCTGCGGGGAGGGCATGTGG + Intronic
1088196377 11:107278392-107278414 AGAGGTCTCGGTAGGGTAGGGGG + Intergenic
1088648913 11:111940222-111940244 AGGGCTCTGTGTAGGAAATGCGG - Intronic
1089627566 11:119761379-119761401 AGACCTCAAGGTAGGGAATGGGG + Intergenic
1089738100 11:120563779-120563801 AGAGCCCTGGGTAGCTCAGGAGG - Intronic
1090427780 11:126621216-126621238 ACAGCTCTGAGTGGGGGATGGGG + Intronic
1091182620 11:133620471-133620493 AGAGCACATGGGAGGGCATGAGG + Intergenic
1091256099 11:134187370-134187392 GGAGCTCTTGGTAATGCATGAGG - Intronic
1091445954 12:544193-544215 GAGGCTCTGGGGAGGGCATGGGG + Intronic
1091590622 12:1840852-1840874 AGAGCTGTGGTTGGGGCAGGTGG + Intronic
1092016500 12:5163286-5163308 AGGGCTCTGGTAATGGCATGAGG + Intergenic
1095947968 12:47764584-47764606 AGAGCACTGGCTGGGGCAGGGGG + Intronic
1096196358 12:49651347-49651369 AGGGCTCTGGGCAGGGCTGGTGG - Intronic
1096387491 12:51204426-51204448 AAAGCTCTGGGTATGGTTTGGGG + Intronic
1097221907 12:57456009-57456031 AGAGCAGTGGGCAGGGCTTGGGG + Intronic
1098848069 12:75562176-75562198 AGAGCTCTGTGATGGGCATCAGG - Intergenic
1101875214 12:108592966-108592988 AGAGTTGTGGGTAGGGGGTGAGG - Intronic
1102229649 12:111253487-111253509 GGAGTCCTGGGCAGGGCATGTGG - Intronic
1103893668 12:124258541-124258563 AGCGCGCTGGGTAAGGGATGAGG + Intronic
1107371631 13:39756730-39756752 AGAGCTCTGGGCGGGGCGGGGGG + Intronic
1111969983 13:94901905-94901927 ATAGCTATAGGTAGGGTATGTGG - Intergenic
1112032888 13:95473669-95473691 AGAGCTCTGGGGACGGCACCCGG - Intronic
1112931078 13:104738909-104738931 AGAGCTCAGGGTAAGCAATGGGG + Intergenic
1113187178 13:107701651-107701673 AGAGATCTAGGTAGAACATGAGG + Intronic
1113922497 13:113921134-113921156 AGCCCTCGGGGTAGGGCCTGGGG + Intergenic
1113942925 13:114027988-114028010 ACAGCTCTGGGTCAGGCAGGAGG + Intronic
1114186027 14:20403219-20403241 AGAGCACTGGGAAAGGCATGTGG - Intronic
1114599726 14:23944695-23944717 ATAGCTCTGGGAATGGAATGCGG - Intergenic
1115354795 14:32435810-32435832 GGAGCTCTGGTTACTGCATGTGG + Intronic
1115746573 14:36443876-36443898 AGGGCTCTGGGAAGGTCGTGGGG - Intergenic
1117791930 14:59350601-59350623 AGAGCTCTAGGGAGGGGAGGAGG - Intronic
1118035877 14:61865277-61865299 AGAGGGATGTGTAGGGCATGAGG - Intergenic
1118327516 14:64791695-64791717 TGGGGTGTGGGTAGGGCATGGGG - Intronic
1118500239 14:66355615-66355637 ACAGCTCTGGGCAGGTCATGAGG + Intergenic
1118875861 14:69784465-69784487 AGAGCTCTGGCGGTGGCATGGGG + Intronic
1121548428 14:94779958-94779980 AGTCCTCTGGGTAGGTCTTGAGG + Intergenic
1121599142 14:95190269-95190291 ACAGCTCTGGACAGGGCATCAGG + Exonic
1123938873 15:25207125-25207147 TGAGCTCTGGCTAGTGCCTGTGG + Intergenic
1124365983 15:29071919-29071941 AGTCCCATGGGTAGGGCATGGGG + Intronic
1125688046 15:41575280-41575302 AGAGCTCAGGGCATGGCAAGGGG + Intronic
1125755417 15:42060875-42060897 AGAGCTCTGCGTTGGGATTGAGG + Intergenic
1126575145 15:50189141-50189163 GGACCACTGGGTTGGGCATGAGG + Intronic
1126689291 15:51275372-51275394 AAAGCTCTGAGTAGGGCTGGAGG - Intronic
1129666390 15:77581892-77581914 AGAGCTCAGGGTAGGGTAATAGG - Intergenic
1130374470 15:83316181-83316203 AGAGCTGGGGGTGGGGAATGAGG - Intergenic
1131262591 15:90895420-90895442 ACAGCTCTGGGCAGGGCAGACGG - Exonic
1131282729 15:91034111-91034133 AGAGCTCTGGGAGGAGCAGGGGG - Intergenic
1132362886 15:101232819-101232841 AGAGCTCTGGGCACTGCAGGTGG + Intronic
1132890133 16:2199681-2199703 AAAGCTCTGGTATGGGCATGAGG + Intergenic
1132939250 16:2498832-2498854 GGAGCTCTGGGTTGGGCCTGGGG + Intronic
1133130552 16:3673879-3673901 GGCGCTCTGGGAAGGGCCTGTGG - Intronic
1134197690 16:12171482-12171504 AGGGCTCTAGGGAGGGCAGGAGG + Intronic
1134450334 16:14359483-14359505 AGAGCCCTGGGGAGGGGATTTGG + Intergenic
1135379794 16:21986105-21986127 AACGCTCTGGGTAGGCCAAGTGG - Intronic
1135467618 16:22700952-22700974 GGAGCCATGGGTAGGGCTTGGGG + Intergenic
1135773285 16:25234082-25234104 AGGGCTCTAGGTAGGCCAAGGGG - Intergenic
1136298805 16:29319632-29319654 AGAGCTCTCCGTAGCGCAGGTGG + Intergenic
1137394062 16:48104743-48104765 AGGGCCCTGGCTAGAGCATGTGG - Intronic
1137550118 16:49431795-49431817 AGAACTCTGGGTGGGCAATGGGG - Intergenic
1137625803 16:49907716-49907738 TGGGCTCAGGGTAGGGCCTGAGG - Intergenic
1138010375 16:53373567-53373589 GTCGCTGTGGGTAGGGCATGTGG + Intergenic
1138054228 16:53815502-53815524 ATGGCACTGGGGAGGGCATGAGG - Intronic
1138387530 16:56646220-56646242 CCAGCTCTGGAGAGGGCATGAGG - Intronic
1138609976 16:58115226-58115248 AGAGCCCTGGGTTGGGGATAGGG - Intronic
1139490192 16:67281841-67281863 AGTACACTGGGTGGGGCATGGGG + Intronic
1139587535 16:67913771-67913793 ATAGGTCTAGGTAGGGCCTGAGG + Intronic
1139750768 16:69107637-69107659 TGCGCTCTGGGTAGGGGAAGGGG - Exonic
1142060474 16:88026130-88026152 AGAGCTCTCCGTAGCGCAGGTGG + Intronic
1142225132 16:88873507-88873529 ATAGCTCTGGGGAGGGGACGGGG - Intergenic
1142494119 17:297213-297235 GGTGCCCTGGGTGGGGCATGTGG - Intronic
1142855051 17:2724542-2724564 AGAGCGCGGGGTCGGGCATGGGG + Intergenic
1143020878 17:3916694-3916716 GGAGCTCTGGCCAGGGCCTGGGG + Intergenic
1143112610 17:4560649-4560671 ACAGGTCTGGGCAGGGCACGGGG + Exonic
1143186807 17:5014909-5014931 AGAGGTCTGGGTTGGGCACCAGG + Intronic
1143312193 17:6001629-6001651 AGGGCTGTGGGTGGAGCATGGGG + Intronic
1143374227 17:6457902-6457924 AGAGACCTGGGTTGGGCCTGGGG - Intronic
1144658228 17:17051670-17051692 AGAGCTCTGGGTAGGGCATGGGG - Intronic
1145271212 17:21405801-21405823 GGAGCTCTGGCCAGGGCATGTGG + Intronic
1145309416 17:21693188-21693210 GGAGCTCTGGCCAGGGCATCCGG + Intronic
1146414747 17:32621646-32621668 AGAGCTTGGGGAGGGGCATGAGG - Intronic
1147338946 17:39742611-39742633 AGAGCTCAGGGAAGGGGTTGGGG - Exonic
1147660573 17:42114918-42114940 ACAGCTCCGTGTAGGGGATGCGG + Exonic
1148352288 17:46949813-46949835 TGTGCTCTGGGAAGGGCAGGAGG + Intronic
1148442599 17:47719503-47719525 AGTGCTCTGGGCAGGGGCTGGGG + Intergenic
1151282520 17:73087602-73087624 AGAGGTGTGGGGAGGGCATATGG + Intronic
1151318953 17:73341366-73341388 GGAGCTCAGGGTAGGGGAAGGGG - Intronic
1151337768 17:73450162-73450184 AGGGCTCTGGCTGGGGCACGGGG + Intronic
1151529373 17:74694941-74694963 CTAGCTCTGGGTTGGGCTTGGGG - Exonic
1151920796 17:77153758-77153780 AGAGCTCTGGATAGGGCTGTTGG + Intronic
1151933121 17:77245260-77245282 AGAGCTTTGGGAAGGAAATGTGG + Intergenic
1151984369 17:77532567-77532589 AGAGCTCTGGAGAGGGCCTTTGG + Intergenic
1152398526 17:80049841-80049863 TGAGCCCTGGGTCGGGCAGGAGG + Intronic
1152563669 17:81090827-81090849 ACAGCCCTGGGTGGGGCAAGGGG - Intronic
1152653596 17:81508868-81508890 TGAGCACTGGCCAGGGCATGGGG - Intergenic
1153491688 18:5655966-5655988 GGACCTCTGGCTAGGGAATGGGG - Intergenic
1157175077 18:45444230-45444252 AGAGCTCTGGCTAGGGAGTCTGG + Intronic
1157442545 18:47721770-47721792 AGAGCTCGGGGAGGGGCAAGAGG + Intergenic
1157625508 18:49047606-49047628 AGAGCACTGTGCAGGGCAGGTGG - Intronic
1157863930 18:51165079-51165101 AGAGGCCTGGGAAGGGCCTGGGG + Intergenic
1160669130 19:348432-348454 GGAGCTGTGAGTAGTGCATGGGG + Intergenic
1160811275 19:1013967-1013989 AGAGGCCTGGGCAGGGCAGGGGG - Intronic
1163306635 19:16483797-16483819 TGTGCTCTGGGGAGGGCATTTGG + Intronic
1163818906 19:19485030-19485052 ACAGCTCTAGGAAGGTCATGTGG - Intronic
1165112569 19:33510934-33510956 AGAGAGCTGGGTTGGGCCTGGGG - Intronic
1165411883 19:35666955-35666977 TGAGCTCGGGGTGGGGGATGAGG + Intronic
1165483723 19:36082541-36082563 GTAGCACTGGGTAGGGAATGAGG - Intronic
1165900501 19:39167261-39167283 AGAGGCCTGGGCTGGGCATGGGG + Intronic
1166605721 19:44141325-44141347 TGAGCGCTTGGTAGGGAATGTGG - Intergenic
1166794657 19:45419281-45419303 AGGGCTCAGAGTACGGCATGGGG + Intronic
1167457262 19:49603234-49603256 AGTGCTCTGCACAGGGCATGCGG + Intronic
1168181314 19:54664547-54664569 AGAGCTCTGGGCAGGGATGGAGG + Intronic
1168567230 19:57435397-57435419 AGAGCTCTGGGTCGGGACTGAGG + Exonic
925442814 2:3903119-3903141 AGAGCTTTGGGGATGGGATGCGG - Intergenic
925691014 2:6523328-6523350 AGAGCTCAGGGTAGGGCTCCAGG - Intergenic
926531119 2:14046930-14046952 ACATTTCTGGGCAGGGCATGTGG + Intergenic
926550493 2:14295153-14295175 AGATTTCTGGGTTGGGTATGTGG - Intergenic
927154689 2:20214686-20214708 TGAGCTCTGGGCAAGGCATGTGG - Intronic
927491880 2:23526302-23526324 AGAGCTGTGGTCAGGGCATGCGG + Intronic
928206479 2:29288175-29288197 ACAGGTCTGAGTAGGGCAGGGGG + Intronic
929592060 2:43153885-43153907 AGACCTATGAGTAGAGCATGTGG + Intergenic
933243388 2:79948009-79948031 AAAGGTCTGGCTAGGTCATGTGG + Intronic
934699594 2:96429047-96429069 AGAGCTATGGGGAGGGGCTGGGG - Intergenic
934858277 2:97742422-97742444 CGAGCTCTGTGCTGGGCATGAGG - Intergenic
935422597 2:102885502-102885524 ACAGGTCTGGATATGGCATGGGG + Intergenic
935696493 2:105775344-105775366 AGAGATCAGGGAAGGGAATGAGG - Intronic
937906658 2:127055864-127055886 TGACCTTTGGGTGGGGCATGGGG - Intronic
943650531 2:190453286-190453308 TGGGCTCTGGGTAGGGGAAGAGG + Intronic
946187377 2:217988666-217988688 AGAGGTCTGGCTGGGGCTTGCGG - Intronic
946707812 2:222475940-222475962 AGAGCTCTAGGCCTGGCATGTGG + Intronic
946869832 2:224075430-224075452 AGGGGTCTGAGTGGGGCATGTGG - Intergenic
947169449 2:227296824-227296846 ATAGCTCAGGGGAGGGCTTGGGG - Intronic
947915394 2:233829000-233829022 TGAGCTCCGGGAAGGGGATGTGG + Exonic
948818870 2:240528347-240528369 GGAGCTCTGGGTAGGGTAGGAGG + Intronic
1168821441 20:776032-776054 AGAGCTCGGGGAAAGGCAGGCGG + Intergenic
1170647928 20:18213293-18213315 AGAACTCAGGGCAGGGCAGGGGG - Intergenic
1170960876 20:21024734-21024756 AGAGGTCTGGGGAGGGACTGTGG - Intergenic
1171093254 20:22306201-22306223 AGAGCTCTGGAAATGGCATGAGG - Intergenic
1171139651 20:22729736-22729758 AGAGCTGTGGGTGGGGTGTGGGG + Intergenic
1172880060 20:38193985-38194007 AGAGCTCAGGGCAGGGCTGGGGG - Intergenic
1174497700 20:50959944-50959966 AGAGGGATGTGTAGGGCATGAGG - Exonic
1175276031 20:57771359-57771381 GGAGCTCGGAGGAGGGCATGTGG + Intergenic
1175311432 20:58014426-58014448 AGAGCTGAGGTCAGGGCATGGGG + Intergenic
1175937940 20:62523532-62523554 AGGGCTCTGGGGAGGGCCGGGGG - Intergenic
1176131058 20:63496998-63497020 AGAGTCCTGGGTGGGGGATGGGG + Intronic
1180787054 22:18553211-18553233 AGAGCTCTGGGTCCTGCAGGAGG + Intergenic
1180798364 22:18619145-18619167 AGTGCTCTGGGTGAGGAATGTGG + Intergenic
1180933454 22:19608740-19608762 AGATCTCTGAGGAAGGCATGAGG - Intergenic
1181062148 22:20286647-20286669 AGAGACCTGGGGAGGGGATGTGG + Intergenic
1181223354 22:21376120-21376142 AGTGCTCTGGGTGAGGAATGTGG - Intergenic
1181234686 22:21442095-21442117 AGAGCTCTGGGTCCTGCAGGAGG - Intronic
1181243963 22:21492736-21492758 AGAGCTCTGGGTCCTGCAGGAGG + Intergenic
1181255386 22:21559506-21559528 AGTGCTCTGGGTGAGGAATGTGG + Intronic
1181518431 22:23431647-23431669 AGACCACTGGGTAGAGCAAGGGG + Intergenic
1181541601 22:23575941-23575963 AGAGGTCTGGGTGGGGTCTGGGG - Intronic
1181582401 22:23835462-23835484 AGAGCTCTGATTAGGGATTGGGG + Intronic
1181796786 22:25317365-25317387 AGAGGTCTGGGTGGGGGCTGGGG + Intergenic
1182005335 22:26955079-26955101 TGAGCTCTGGGCTGGGCATCAGG + Intergenic
1182281690 22:29221037-29221059 AGAGATTAGGGGAGGGCATGGGG + Intronic
1182723212 22:32421381-32421403 AGAGCTCTGGGATGGGCATCAGG - Intronic
1183951621 22:41355935-41355957 AGAGCTGTGGGGTGGGCGTGGGG - Exonic
1184191599 22:42898683-42898705 TGGGCTCGGGGAAGGGCATGGGG - Intronic
1184421566 22:44385435-44385457 TGGGTGCTGGGTAGGGCATGGGG - Intergenic
1184497430 22:44850073-44850095 TGACCTCTGGGGAGGGCATGGGG + Intronic
1184741178 22:46429913-46429935 AAAGGGCTGGGCAGGGCATGGGG - Intronic
950520119 3:13493164-13493186 GGAGCTGTGGGTGGGGCAGGTGG - Intronic
950594295 3:13965242-13965264 AAAGCTCTGGATTGGGGATGGGG + Intronic
950768080 3:15288777-15288799 AATGCTCTGGGTAAGACATGAGG + Intronic
952386241 3:32843522-32843544 AGAGCTCTGGGAAGGAAATCTGG + Intronic
953380949 3:42472742-42472764 AGGGCTCTGAGTTGAGCATGTGG - Intergenic
953637843 3:44677733-44677755 AGAGGTTTGGGGAGGGGATGGGG + Intergenic
953669555 3:44951299-44951321 AGAGCTCTGTGCAGAGAATGTGG - Intronic
954295643 3:49673426-49673448 AGAGCTCAGGGTGAGGCCTGGGG + Intergenic
954701151 3:52451550-52451572 AGGGCTGTGGGGAGGGCATGAGG + Intronic
956647087 3:71466766-71466788 AGAGCACTGCCTAGGGCAGGGGG + Intronic
960956327 3:123034011-123034033 ATATCTCTGGGTAGGGCATAAGG + Intergenic
961801333 3:129452405-129452427 AGAGTGCTGGGCAGGGCAGGGGG + Intronic
963046823 3:141108698-141108720 AGGGCTCTGGGTAGTGCAGGAGG + Intronic
963049122 3:141126928-141126950 AGAGCCCGGGCTGGGGCATGGGG - Intronic
963699132 3:148601816-148601838 AGAGCTTTGGGTGGTCCATGTGG - Intergenic
964763927 3:160160091-160160113 AGGTTTCTGGGTAGGGAATGCGG + Intergenic
967478101 3:189943908-189943930 AGAGCTCTAGGAAGACCATGGGG + Intergenic
967959555 3:194909566-194909588 AGCTCTTTGGGTAGGGCCTGGGG + Intergenic
968510205 4:992255-992277 AGGGCTCTGGTGTGGGCATGGGG - Intronic
968757783 4:2425869-2425891 AGGGCCCTGGGGAGGGCTTGCGG - Intronic
968872043 4:3247146-3247168 AGAACCCTGGGGAGGTCATGGGG - Intronic
969174169 4:5386101-5386123 AGAGCTGTGGGTGGGGCCTGTGG - Intronic
969603988 4:8193141-8193163 CGTGCTCTGGGTAGGGCCGGGGG - Intronic
970451386 4:16169622-16169644 AGAGCTGTGTGTAGGTCATGTGG - Intronic
973191042 4:47386276-47386298 AGAGCTCTGTGTCAGGAATGAGG + Intronic
974800811 4:66815448-66815470 AGAGCACTGGGTGGGGAATCTGG - Intergenic
976892414 4:90066114-90066136 AGAGCTCTGGATAAGGAATAAGG + Intergenic
977159752 4:93618799-93618821 GGGGCTCTAGGTAGAGCATGTGG - Intronic
977227393 4:94409293-94409315 TGAGCTGTGGGAATGGCATGGGG - Intergenic
978299561 4:107251379-107251401 AGAGCTCTGGGTAGAGCTCTTGG + Intronic
978480793 4:109188239-109188261 AAAGAACTGGATAGGGCATGAGG - Intronic
978710191 4:111770693-111770715 AGGGCTGGGGGTAGGGCAAGGGG + Intergenic
978876532 4:113646457-113646479 GGAGTGCTGGGTGGGGCATGGGG + Intronic
979950565 4:126887746-126887768 AGTGCTCTGGGGAGGGAAGGAGG + Intergenic
980701776 4:136441919-136441941 ACAGCTGTGGGGAGGGCATGGGG + Intergenic
981928375 4:150164284-150164306 AGTGGTCTGGGTTGGGCCTGTGG + Intronic
983124195 4:163930389-163930411 AGACCTTTGGGGAAGGCATGAGG + Intronic
983906751 4:173191209-173191231 AGATCTCTGGGGATGGGATGGGG + Intronic
984870090 4:184317745-184317767 AGGCCTCTGGGTAAGGGATGGGG - Intergenic
985547413 5:516695-516717 AGAGCTCTGTGTGGGGCAGATGG + Intronic
986003408 5:3648237-3648259 AGAATTCTGAGTAGGGCATCAGG + Intergenic
986212781 5:5689911-5689933 AGTGATCTGAGTAGGGCAGGAGG + Intergenic
987160770 5:15139956-15139978 AGTGCTCTGGGTGAGGCAGGAGG - Intergenic
988855965 5:35228711-35228733 AGAGCTCTGGAGAGAGCATGTGG + Intronic
991109215 5:62879651-62879673 AGAACTGAGGGCAGGGCATGAGG - Intergenic
991618199 5:68518330-68518352 TGACCTCTTGGCAGGGCATGTGG + Intergenic
995639990 5:114244585-114244607 AAAACTCTGGGGCGGGCATGGGG + Intergenic
995766289 5:115623365-115623387 AGAGCTCTGGGTTGGGGGTGTGG + Intronic
996019221 5:118573496-118573518 AGAACTCTGGCCAGTGCATGTGG + Intergenic
997697568 5:135873586-135873608 AGAGCCCAGGGTGAGGCATGAGG - Intronic
998681088 5:144468129-144468151 AGACATCTGAGGAGGGCATGTGG - Intronic
999716006 5:154360488-154360510 AGAGCTCTGCTTATGTCATGTGG - Intronic
1001274718 5:170342253-170342275 AGCGTTCTGGGAAGGGCAAGAGG - Intergenic
1001912935 5:175535927-175535949 TGGGCGCTGGGTAGGACATGAGG + Intergenic
1002097433 5:176839700-176839722 GGCGCTCTGGGGAGGGCCTGGGG + Intronic
1002704161 5:181148974-181148996 AGAGCTCTGGGGAGAGCAGAAGG + Intergenic
1003017310 6:2478458-2478480 AGGCCTCTGGGTAGGGCCAGAGG + Intergenic
1003595141 6:7468031-7468053 ATAGGTCTGGGTGGGGCCTGAGG - Intergenic
1004099259 6:12592121-12592143 AAAGCTCAGTGTTGGGCATGTGG + Intergenic
1004909006 6:20265023-20265045 AGAACTCTGGGAAGGAGATGTGG - Intergenic
1005830913 6:29670526-29670548 AGAGCCTGGGGTTGGGCATGGGG - Intronic
1007461200 6:42020473-42020495 CTAGATCTGGGGAGGGCATGTGG - Intronic
1007931613 6:45696895-45696917 AGAGGTATAGGGAGGGCATGGGG + Intergenic
1008556885 6:52681168-52681190 AGTGCTCTGGGGTGGGTATGTGG + Intronic
1008661371 6:53671464-53671486 AGAGCTGTGGCTGGGCCATGAGG + Intergenic
1012186439 6:96223032-96223054 AGGGGTCTGGGGAGGGCAAGTGG - Intergenic
1013587355 6:111591395-111591417 AGAGGTCTGGGGAGGTCCTGGGG + Exonic
1015994125 6:138980495-138980517 AGAGAACTGGGAAGGGCCTGAGG - Intronic
1016241489 6:141936527-141936549 AGAGCCCTGGGAAGGGCAAAGGG - Intergenic
1017455341 6:154596570-154596592 AGAGGCCTGGTTAGGGCTTGGGG - Intergenic
1017722125 6:157250931-157250953 AGAGCTCTGGTTGGGGCATCCGG - Intergenic
1020575760 7:9925092-9925114 ACAGTTCTGGGGAGAGCATGAGG - Intergenic
1021027385 7:15686279-15686301 AGAGCTCGGGGTAAGACATATGG + Exonic
1022506966 7:30913477-30913499 GGGGCTGTGGGCAGGGCATGTGG + Intronic
1022643409 7:32208864-32208886 AGGGCTGTGGTTAGGCCATGGGG - Intronic
1023464181 7:40435608-40435630 TGAGCTCTGGGGAGGGTAGGTGG - Intronic
1023912403 7:44565335-44565357 AGAGCTCAGGCCAGGGCATAAGG + Intergenic
1027268388 7:76506174-76506196 GGAGATCAGTGTAGGGCATGTGG - Intergenic
1028018496 7:85743440-85743462 AGGGCTCTTGGTAGGACTTGAGG + Intergenic
1029491473 7:100872785-100872807 AGGGTGCTGGGTAGAGCATGAGG + Intronic
1030647174 7:112074742-112074764 AGATCTCTGGGTAGAGGCTGGGG - Intronic
1032597171 7:133253302-133253324 AGAGCCCTGGGGAGGGGCTGCGG - Intronic
1034027228 7:147719219-147719241 AGATCTGTGGGTGGGGCATTTGG - Intronic
1034224414 7:149471669-149471691 AGATCACTGGGGAGGGTATGGGG + Intergenic
1034528473 7:151681046-151681068 AGAGCTCTCGGCAGGGGGTGGGG - Intronic
1034895287 7:154872514-154872536 GGTGCTCTGGGTGGGGCCTGAGG - Intronic
1036202208 8:6779094-6779116 AGAGCTCTGGATCGGAAATGGGG - Intergenic
1037154512 8:15684093-15684115 AGTGCTCTGGGGAGGGAAGGCGG + Intronic
1037309305 8:17537575-17537597 AGTGCTGTGGGGAGGGCAGGAGG + Intronic
1037820636 8:22133236-22133258 GGGGCTCTGGGGATGGCATGAGG - Intronic
1039838264 8:41275197-41275219 AAAGCTCTGGGTAGGGAAGCAGG - Intronic
1039838428 8:41276323-41276345 ACAGCACTGGGTACGGCATTTGG + Intronic
1046662605 8:116964679-116964701 AGAGCTCTGGGTATCTTATGTGG - Intronic
1046717838 8:117586736-117586758 AGAGCTCTGGATAGGGAATCAGG + Intergenic
1046954455 8:120048252-120048274 AAAGCTCTGGGTTGGGAAGGAGG + Intronic
1048469753 8:134695927-134695949 AGAGATGCGGGTAGGGCCTGGGG - Intronic
1048802419 8:138206496-138206518 AGAGCTGTGGGTAGGTCGAGGGG - Intronic
1048964384 8:139604757-139604779 TGAGCCCTGGGTAGGCCCTGGGG + Intronic
1049032482 8:140047958-140047980 TGAGCTCTGGCTGGGGCCTGTGG - Intronic
1049581126 8:143411462-143411484 CAAGCCCTGGGTAGGGCCTGGGG + Intergenic
1049637612 8:143697456-143697478 AGGGCTCCGGGTAGAGCAGGGGG + Intronic
1049808786 8:144553904-144553926 CGAGCTCTGTGTGGGGCATTGGG - Intronic
1050061792 9:1717131-1717153 AGAGCTGTGGGTAAGGGAAGTGG - Intergenic
1055226148 9:73998925-73998947 AAAGCTTAGGGTAGGGGATGGGG + Intergenic
1056762731 9:89426511-89426533 AGAGCTCTGGCTGGAGCTTGTGG - Intronic
1057855763 9:98599666-98599688 CGGGCTCTGAGCAGGGCATGCGG + Intronic
1059590274 9:115651536-115651558 AGAGCTCTGGGTATAGCTGGAGG + Intergenic
1059765183 9:117377254-117377276 AGGGCTCTGAATAGGGCAGGAGG + Intronic
1060115264 9:120935418-120935440 AGAGCTGTGGGTAGGGCCCATGG + Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060795628 9:126510801-126510823 AGAGGTCTGGGAAGGCCCTGAGG + Intergenic
1060896040 9:127218231-127218253 AGAGCTGTGGGAAGGTCTTGGGG + Intronic
1062160904 9:135079202-135079224 AGTGCTCTGGGTAGGAGTTGGGG + Intronic
1062173768 9:135149473-135149495 AGAGCTCAGGGTGAGGCCTGGGG + Intergenic
1062206762 9:135341823-135341845 AGGGCTCTGGGGAAGGCGTGCGG + Intergenic
1062285417 9:135770555-135770577 AGGGCTCGGGGGAGGGCATCAGG + Intronic
1062724217 9:138062222-138062244 AGAGCCCTGGGCAGGGTATCTGG - Intronic
1185683204 X:1906055-1906077 AGGGCTCTGGCCAGGGCAGGGGG + Intergenic
1186454270 X:9698895-9698917 AGAGCCCTGGGTAACGCATGTGG - Intronic
1186598394 X:11009300-11009322 AGAGATCTGGATAGGGGCTGGGG - Intergenic
1186705562 X:12136689-12136711 GGGGCTCGGGGTAGGGGATGAGG + Intergenic
1187795997 X:23005222-23005244 ACAGCTATGGGTAGGGGGTGAGG + Intergenic
1187979913 X:24745294-24745316 ACAGCTCTGGGTAGTGTATATGG + Intronic
1188368539 X:29340340-29340362 AGAGCTGGGGGTAGGGGAAGTGG - Intronic
1189301974 X:39958643-39958665 AGAGCCCTAGGGTGGGCATGAGG - Intergenic
1189585877 X:42461230-42461252 ATAACTTGGGGTAGGGCATGGGG - Intergenic
1189737243 X:44084206-44084228 TGAGCTTTGGGCAGGGTATGGGG - Intergenic
1190507253 X:51138375-51138397 AGAGCTTTGAGTAAGGCATTTGG + Intergenic
1190758893 X:53423484-53423506 AGAGCTGTGGGAATGGGATGGGG - Intronic
1190790149 X:53691650-53691672 ACAGCTCTGGCAAGGGTATGGGG - Intergenic
1198670927 X:139080162-139080184 AGATTTCTTGGCAGGGCATGGGG - Intronic
1200077106 X:153556673-153556695 AGGGATCTGGTTAGGGCCTGGGG - Intronic