ID: 1144658229

View in Genome Browser
Species Human (GRCh38)
Location 17:17051671-17051693
Sequence GAGAGCTCTGGGTAGGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 241}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144658229_1144658238 1 Left 1144658229 17:17051671-17051693 CCCATGCCCTACCCAGAGCTCTC 0: 1
1: 0
2: 1
3: 24
4: 241
Right 1144658238 17:17051695-17051717 AGGCATTGTCACTTCCGTTGGGG 0: 1
1: 0
2: 0
3: 9
4: 144
1144658229_1144658239 2 Left 1144658229 17:17051671-17051693 CCCATGCCCTACCCAGAGCTCTC 0: 1
1: 0
2: 1
3: 24
4: 241
Right 1144658239 17:17051696-17051718 GGCATTGTCACTTCCGTTGGGGG 0: 1
1: 0
2: 0
3: 5
4: 57
1144658229_1144658243 18 Left 1144658229 17:17051671-17051693 CCCATGCCCTACCCAGAGCTCTC 0: 1
1: 0
2: 1
3: 24
4: 241
Right 1144658243 17:17051712-17051734 TTGGGGGCAAGAGCACCTAGGGG 0: 1
1: 0
2: 1
3: 10
4: 139
1144658229_1144658244 19 Left 1144658229 17:17051671-17051693 CCCATGCCCTACCCAGAGCTCTC 0: 1
1: 0
2: 1
3: 24
4: 241
Right 1144658244 17:17051713-17051735 TGGGGGCAAGAGCACCTAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 164
1144658229_1144658236 -1 Left 1144658229 17:17051671-17051693 CCCATGCCCTACCCAGAGCTCTC 0: 1
1: 0
2: 1
3: 24
4: 241
Right 1144658236 17:17051693-17051715 CAAGGCATTGTCACTTCCGTTGG 0: 1
1: 0
2: 0
3: 6
4: 74
1144658229_1144658241 16 Left 1144658229 17:17051671-17051693 CCCATGCCCTACCCAGAGCTCTC 0: 1
1: 0
2: 1
3: 24
4: 241
Right 1144658241 17:17051710-17051732 CGTTGGGGGCAAGAGCACCTAGG 0: 1
1: 0
2: 0
3: 7
4: 101
1144658229_1144658237 0 Left 1144658229 17:17051671-17051693 CCCATGCCCTACCCAGAGCTCTC 0: 1
1: 0
2: 1
3: 24
4: 241
Right 1144658237 17:17051694-17051716 AAGGCATTGTCACTTCCGTTGGG 0: 1
1: 0
2: 1
3: 10
4: 73
1144658229_1144658242 17 Left 1144658229 17:17051671-17051693 CCCATGCCCTACCCAGAGCTCTC 0: 1
1: 0
2: 1
3: 24
4: 241
Right 1144658242 17:17051711-17051733 GTTGGGGGCAAGAGCACCTAGGG 0: 1
1: 0
2: 0
3: 6
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144658229 Original CRISPR GAGAGCTCTGGGTAGGGCAT GGG (reversed) Intronic
900139167 1:1132286-1132308 GCGAGCCCTGCGTTGGGCATTGG + Intergenic
900972893 1:6001231-6001253 AAGGGCTCAGGGTAGGGCCTGGG - Intronic
901062017 1:6475931-6475953 GAGAGCTCTGTGGATGGCAAAGG - Exonic
901737529 1:11321966-11321988 GGGTGCTCTGGGCAGGGCAGGGG - Intergenic
901873906 1:12155129-12155151 GAGACCTCTGGGGAGGGCTTTGG + Intergenic
902263737 1:15246858-15246880 TAGAGATTTGGGTAGGGCAGGGG + Intergenic
903624450 1:24720909-24720931 GAGGGCTCTGGGTAAGGAAATGG + Intergenic
903678753 1:25083177-25083199 GTCAGCTCTGGGTTGGGGATTGG - Intergenic
903955239 1:27021081-27021103 CAGAGCCCTGGGTAGGGAATAGG - Intergenic
905118973 1:35667117-35667139 GAGAGCTCTGGAGAGGGCAGAGG - Intergenic
907724967 1:57011243-57011265 GAGAGCTCTGTCTAGGGGCTGGG + Exonic
909693419 1:78436502-78436524 GGGAGCTCTGGGTCTGGGATAGG + Intronic
910112229 1:83694899-83694921 GAGAGCTCTGGCTGGTGCAAAGG - Intergenic
910877154 1:91887821-91887843 GAGAGCCCTGAGTCAGGCATTGG + Intronic
911047746 1:93642632-93642654 TAGAGCTCAGGGGAGGGCAGAGG + Intronic
912068180 1:105773707-105773729 TAAAGCTGTGGGTAGGGAATGGG - Intergenic
914353389 1:146860026-146860048 GAGAGCTGTGGCCAGGGCAGAGG + Intergenic
915597398 1:156903452-156903474 AAGTGCCCTGGGTAGGGCCTGGG + Intronic
915669428 1:157476444-157476466 GGGAGCTGGGGATAGGGCATGGG + Intergenic
916077323 1:161209408-161209430 GAGAGGTCTGGGCAGAGCCTGGG - Intronic
916194432 1:162210307-162210329 CAGAGCTGTGGGCTGGGCATGGG - Intronic
917716732 1:177745815-177745837 GAGTGATCTGGCTAGGGCATAGG - Intergenic
918431279 1:184463244-184463266 GTGATCTCAGGGTAGGGCTTGGG + Intronic
919806039 1:201381575-201381597 GAGGTCTCTGGGCAGGACATAGG + Exonic
920189024 1:204180585-204180607 GAGAGCTCTGGGCAAGGGATGGG + Intergenic
923482942 1:234401818-234401840 GAGAGGGTTGGGGAGGGCATAGG - Intronic
1063871356 10:10421045-10421067 GTGAGATGTGGGAAGGGCATTGG - Intergenic
1064409008 10:15089027-15089049 GAGAGGTCTCCGTAGGGCACAGG + Intergenic
1065979228 10:30875132-30875154 TTGAGCTCTGGGTAGGGCCAAGG + Intronic
1068247487 10:54391501-54391523 GAGAGGTGTGAGTAGGGTATAGG + Intronic
1069834999 10:71302655-71302677 GGGAGCTCTTGGTGGGGCAAAGG + Exonic
1069901344 10:71708286-71708308 GAGGGCTCTGGGCAGGTCAGCGG - Intronic
1071420772 10:85495120-85495142 GAGAGAACTGGGAAGGGCAGAGG - Intergenic
1073566560 10:104540290-104540312 GAGAGGTCTCGGGAAGGCATGGG + Intergenic
1074123818 10:110512649-110512671 GAGAGCTGGGGGAAGGGCAAGGG - Intergenic
1075670952 10:124263854-124263876 AACAGCTCTGGGTCGGGCTTTGG + Intergenic
1077343826 11:2037434-2037456 GGCAGCTCTGGGAAGGGCCTGGG + Intergenic
1077530002 11:3090590-3090612 GAGAGCTCTGGGCAGGACTCAGG + Exonic
1078055447 11:8005433-8005455 GAGGGCTCTGGCTTGGGCAATGG - Intergenic
1078141213 11:8694286-8694308 GAGAGCTCTAATTAGGGCACCGG + Intronic
1078766883 11:14306737-14306759 AAAAGCTCAGGGTAGGGAATGGG - Intronic
1079434239 11:20429737-20429759 AAGTGCTCTAGGTGGGGCATTGG + Intronic
1079486226 11:20938519-20938541 GAGAGGTCTGAGTTGGGGATGGG + Intronic
1079987369 11:27213137-27213159 GAGTGCCCTGGGTAAGGAATTGG - Intergenic
1080876827 11:36282699-36282721 GAGAGCTCTGGCTAGTACACTGG - Intronic
1082700978 11:56430250-56430272 CTCAGCTCTGAGTAGGGCATGGG + Intergenic
1083195258 11:61082199-61082221 GTGAGGTCTGGGTAGGGTGTGGG - Intergenic
1083370403 11:62174355-62174377 CAGAGCTCTGGGGAGGGTGTGGG + Intergenic
1083490988 11:63014979-63015001 CAGAGCTGTGGGCAGGGCATAGG + Exonic
1083618375 11:64037090-64037112 CAGAGCTCTGGCTTGGGCCTCGG - Intronic
1085282992 11:75342831-75342853 GAGCTCTCTGGGAAGGGGATTGG - Intronic
1085738080 11:79056800-79056822 GAAAGCACAGGGTATGGCATGGG + Intronic
1090363153 11:126187073-126187095 GAGAGCTACGGGCAGGGCCTTGG - Intergenic
1090839814 11:130478000-130478022 GAGAGCTCCAGGTAAGGCAATGG + Intergenic
1202826812 11_KI270721v1_random:92623-92645 GGCAGCTCTGGGAAGGGCCTGGG + Intergenic
1091633805 12:2182379-2182401 GAGAGATTTGGGAAAGGCATTGG - Intronic
1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG + Exonic
1095309661 12:40683221-40683243 GAGAGATCTGGGATGGGGATTGG + Intergenic
1095983068 12:47983629-47983651 GGGAGCCCTGGGTATGGCAAAGG + Intronic
1097221906 12:57456008-57456030 GAGAGCAGTGGGCAGGGCTTGGG + Intronic
1098136726 12:67410756-67410778 AAGAGCTCTGAGTAGGACATTGG - Intergenic
1099961342 12:89400106-89400128 AGGAGCTCTGGGTTGGGCCTGGG + Intergenic
1100372089 12:93977815-93977837 GAGAGCTCTGTGCATGGCAGAGG + Intergenic
1102687938 12:114738874-114738896 GAGAGAGCTGGGAAGGGCAGAGG - Intergenic
1104924260 12:132305882-132305904 GGGAGCCCTGGGTGGGGCTTGGG + Intronic
1106547517 13:30743500-30743522 GAGGGCACTGGGGAGGGAATGGG - Intronic
1107006990 13:35623051-35623073 TAGAGCTCTGGATTGGGAATTGG + Intronic
1108428258 13:50326963-50326985 GAGGTCTCTGGGTGGGGCTTAGG - Intronic
1110840255 13:80134037-80134059 GAGAGCTCTGTGTAGCTGATTGG - Intergenic
1112039630 13:95533872-95533894 CAGAGCTCTGGGTAGAGTCTGGG - Intronic
1112404263 13:99104249-99104271 GAGTGTCCTGAGTAGGGCATGGG + Intergenic
1112572495 13:100606786-100606808 AAGAGCTCTGGAAATGGCATTGG - Intronic
1112832328 13:103468565-103468587 GAGATGTATGAGTAGGGCATTGG + Intergenic
1113390611 13:109892934-109892956 GAGAGGTCTGTGCAGGGCACTGG + Intergenic
1113544790 13:111139826-111139848 GAGAGCACTGGGAAGCCCATGGG + Intronic
1113557671 13:111251495-111251517 GAGTGGTCTGGGTGGGGCAGAGG + Intronic
1113813956 13:113159027-113159049 GGGAGGCCTGGGTTGGGCATTGG + Intronic
1117301053 14:54428438-54428460 GAGTGCTATGGGAACGGCATAGG + Intronic
1117465313 14:55987697-55987719 GAGAGCGTTGGGAAGGGCAGGGG + Intergenic
1118327517 14:64791696-64791718 GTGGGGTGTGGGTAGGGCATGGG - Intronic
1118875860 14:69784464-69784486 GAGAGCTCTGGCGGTGGCATGGG + Intronic
1119020557 14:71108599-71108621 GAGAGCTGTGGCTAGTGCCTAGG - Exonic
1120612128 14:86655034-86655056 GAGAGTGCTGGGTAGAGAATTGG - Intergenic
1121096238 14:91219897-91219919 CAGAGCTCTGGGCAGGGGGTGGG + Intronic
1121479168 14:94247414-94247436 GAGATCCCTGGGCAGGGCAGTGG - Intronic
1122421378 14:101579587-101579609 GAGAGGTCTGGGCTGGGCATTGG + Intergenic
1122890834 14:104731559-104731581 CTGAGCTCTGGGAAGGCCATGGG - Intronic
1122969325 14:105146113-105146135 GGGAGCCCTGGGTAGGGGGTGGG - Intronic
1124365982 15:29071918-29071940 GAGTCCCATGGGTAGGGCATGGG + Intronic
1125889468 15:43254825-43254847 AAGAGCTCTTGGTTGGGCATGGG - Intronic
1128488134 15:68117518-68117540 GAGAACTCTGGGGAGGACAGAGG - Intronic
1128497726 15:68207752-68207774 GAGAGGGCTGGGTGGGGCAGAGG - Exonic
1128801345 15:70499028-70499050 CAAAGCTCTGGTTAGGGCAGAGG + Intergenic
1132939249 16:2498831-2498853 GGGAGCTCTGGGTTGGGCCTGGG + Intronic
1136270593 16:29146140-29146162 GAGACCTGTGTGCAGGGCATGGG - Intergenic
1138307981 16:55995728-55995750 GAGAGTTCTAGGTAAGTCATTGG - Intergenic
1138546375 16:57722187-57722209 CAGACCTATGGGGAGGGCATGGG + Intronic
1138609977 16:58115227-58115249 TAGAGCCCTGGGTTGGGGATAGG - Intronic
1139290676 16:65855427-65855449 GAGAGCTCCAGGGAGGGAATTGG - Intergenic
1139545496 16:67647850-67647872 GAGGGCTCTGGGCCGGGCACTGG + Exonic
1139980634 16:70855492-70855514 GAGAGCTGTGGCCAGGGCAGAGG - Intronic
1140509593 16:75497251-75497273 CATAACTCTGGGTAGGGGATTGG + Intergenic
1140701819 16:77588133-77588155 GAGAGGTGAGCGTAGGGCATGGG - Intergenic
1140969596 16:80000433-80000455 AAGACCTCTGTCTAGGGCATGGG - Intergenic
1141004362 16:80338174-80338196 GAGAGCTGTGGGTGGGGCTCTGG - Intergenic
1142074182 16:88107951-88107973 GAGACCTGTGTGCAGGGCATGGG - Intronic
1142855050 17:2724541-2724563 AAGAGCGCGGGGTCGGGCATGGG + Intergenic
1143312192 17:6001628-6001650 GAGGGCTGTGGGTGGAGCATGGG + Intronic
1144658229 17:17051671-17051693 GAGAGCTCTGGGTAGGGCATGGG - Intronic
1144872256 17:18378469-18378491 GAGAGCTCTGGGGAGGGCTCTGG - Intronic
1147620392 17:41862854-41862876 GAGATCCCTGGGAAGTGCATGGG - Intronic
1147845907 17:43403749-43403771 GAGAGGACTGGAAAGGGCATGGG - Intergenic
1148442598 17:47719502-47719524 GAGTGCTCTGGGCAGGGGCTGGG + Intergenic
1149378388 17:56068409-56068431 GAGTGCTCTAGGTAGAGCAGTGG + Intergenic
1150289977 17:63975530-63975552 GGGAGCCCTGGGTAGGGCTTAGG - Intergenic
1150335206 17:64326025-64326047 GAGGGCTCTGGGCTGGGCAGTGG + Intronic
1150447198 17:65235734-65235756 GAGTTCTCTGGGAAAGGCATGGG - Intergenic
1150450578 17:65263777-65263799 GAGAGAGCTGGAAAGGGCATAGG - Intergenic
1151318954 17:73341367-73341389 GGGAGCTCAGGGTAGGGGAAGGG - Intronic
1151323889 17:73367335-73367357 GAGAGCTCAGGCTGGGGGATTGG - Intronic
1151332962 17:73422085-73422107 GGGTGCTCTGAGTAGGGCACTGG - Intronic
1151749014 17:76026553-76026575 GAGAACTCTGGGGAGGGCTGTGG + Intronic
1152277012 17:79363810-79363832 GAGAGTTCTGAGTGGGGCAGGGG - Intronic
1152802968 17:82340237-82340259 GAGGGCACTGGGGAGGGCACAGG - Intergenic
1152836856 17:82538825-82538847 GTGAGCTGTGGGTATGGCGTAGG - Intronic
1153491689 18:5655967-5655989 GGGACCTCTGGCTAGGGAATGGG - Intergenic
1157562583 18:48659342-48659364 GAGAGCAGTGGGCAAGGCATCGG - Intronic
1157863929 18:51165078-51165100 GAGAGGCCTGGGAAGGGCCTGGG + Intergenic
1157867372 18:51197794-51197816 GAGAGCTCTGGGGAGGGGAGGGG - Intronic
1160505337 18:79423536-79423558 GGGAACTGTGGGTAGGCCATGGG + Intronic
1161478938 19:4501175-4501197 GAGAGATCTGGGTGGGACAGAGG - Exonic
1162478957 19:10916875-10916897 GAGAGCGCTGTGCAGGGCAGAGG - Intronic
1162890850 19:13732081-13732103 GTGAGCGCTGGGTAGGACTTCGG + Intronic
1165112570 19:33510935-33510957 GAGAGAGCTGGGTTGGGCCTGGG - Intronic
1168405503 19:56108313-56108335 GGGAGCTCTGGGCAGGGGCTGGG - Intronic
1168405531 19:56108383-56108405 GGGAGCTCTGGGCAGGGGTTGGG - Intronic
1168405544 19:56108418-56108440 GAGAGCTCTGGGCAGGGGCAGGG - Intronic
927000692 2:18791379-18791401 GAGAGCTCTGTGCAGAGCAAAGG + Intergenic
927450102 2:23201667-23201689 TGGAGCTCTGGGTGAGGCATGGG - Intergenic
927935297 2:27072535-27072557 GAAAGCTCTGGCTTGGGCAGAGG - Intergenic
928206478 2:29288174-29288196 GACAGGTCTGAGTAGGGCAGGGG + Intronic
928936180 2:36680601-36680623 GTGAGCTGGGGGTAGGGCATGGG - Intergenic
931689929 2:64827045-64827067 GAGAGGTCTTGGAAGGACATAGG - Intergenic
933704763 2:85281543-85281565 GTGGGCTCTGGGTAGGGCAAGGG + Intronic
934564010 2:95328445-95328467 GAGAGCGGTGGGGAGGGCAGTGG + Intronic
934659645 2:96136423-96136445 GAAAGCACTGGGTAAGGCACGGG + Intronic
937120312 2:119436257-119436279 GCAAGCTCTGGGTAGGGTACAGG + Intronic
937239315 2:120450136-120450158 GGATGCTCTGGGAAGGGCATGGG + Intergenic
939716703 2:145592794-145592816 GGAAGCTCTGAGTTGGGCATTGG + Intergenic
941268144 2:163389989-163390011 GACAACTCTGGGCAGGGAATGGG - Intergenic
942470541 2:176255214-176255236 GAGGGCTCTGTGGAGGGCAGAGG - Intergenic
944123726 2:196269912-196269934 TAAATTTCTGGGTAGGGCATGGG + Intronic
945935805 2:215901802-215901824 GAGGGCTGTGGGTTGGGCAGGGG - Intergenic
947219132 2:227776204-227776226 GAGAGGTTTTGGTGGGGCATTGG + Intergenic
947834838 2:233167683-233167705 GACAGCTCTGGATAGGCCATAGG - Intronic
948461973 2:238134191-238134213 GAGAGCACTGGGCAGGGAGTCGG + Intergenic
949047512 2:241878665-241878687 GAGAGCTCAGGGGAGGGCTCAGG - Intergenic
1169891143 20:10453392-10453414 GAGAGCTGTGGGTAGACCACAGG - Intronic
1170156382 20:13273184-13273206 GTGAGGTCTAGGTAGGGAATGGG - Intronic
1170647929 20:18213294-18213316 GAGAACTCAGGGCAGGGCAGGGG - Intergenic
1171139650 20:22729735-22729757 GAGAGCTGTGGGTGGGGTGTGGG + Intergenic
1171139658 20:22729791-22729813 GAGAGCTGTGGGCAGGGTGTAGG + Intergenic
1172138749 20:32706692-32706714 CATAACTCTGGGTAGGTCATTGG - Exonic
1172221676 20:33278361-33278383 GGGGGCTGTGGGTCGGGCATTGG + Intronic
1172449946 20:35014918-35014940 GAGAGCTCTGAACAGGACATTGG - Intronic
1172974969 20:38899425-38899447 GAGTCCTTGGGGTAGGGCATGGG - Intronic
1173827285 20:46056082-46056104 GATAGCTCTTTGCAGGGCATGGG + Intronic
1175311431 20:58014425-58014447 GAGAGCTGAGGTCAGGGCATGGG + Intergenic
1175915439 20:62423768-62423790 GAGAGCTCCGGGGAAGGGATGGG + Intronic
1175926288 20:62473207-62473229 GAGCGCTCAGGGCAGGGCAGGGG - Intronic
1175937941 20:62523533-62523555 GAGGGCTCTGGGGAGGGCCGGGG - Intergenic
1176128112 20:63485039-63485061 GTCAGCTCTGGGGAGGGCAGGGG - Intergenic
1178927599 21:36788619-36788641 AGGAGCTCTGGGTAGGGTCTGGG + Intronic
1178932337 21:36830485-36830507 GGGAGCTCTGTGTAGCACATAGG + Intronic
1181518430 22:23431646-23431668 GAGACCACTGGGTAGAGCAAGGG + Intergenic
1182725961 22:32445812-32445834 GAGAGCCCTGGGTTGGGCAGTGG - Intronic
1182775382 22:32827677-32827699 GAGGGCTTTGAGCAGGGCATTGG - Intronic
1184128855 22:42505337-42505359 GAGAGGTGTGGGGAGGGTATTGG - Intergenic
1184137650 22:42558652-42558674 GAGAGGTGTGGGGAGGGTATTGG - Intronic
1184273070 22:43395757-43395779 GTGAGCCCTGGGTAGGTCCTCGG + Intergenic
1184421567 22:44385436-44385458 GTGGGTGCTGGGTAGGGCATGGG - Intergenic
1184497429 22:44850072-44850094 CTGACCTCTGGGGAGGGCATGGG + Intronic
954217298 3:49131762-49131784 GATGGCTCTGGGTTGGGCTTGGG - Intronic
954609941 3:51939046-51939068 GGGAGCTGGGGGTAGGTCATGGG + Intronic
954648410 3:52145178-52145200 GAGAGTACTGGGTAGGGAACTGG - Intronic
960094693 3:113677925-113677947 GAGAGGTCTGGGTAGGGCCCAGG + Intronic
960505576 3:118489287-118489309 GAGAGCTCTGGAAAGGCCTTGGG + Intergenic
961801332 3:129452404-129452426 GAGAGTGCTGGGCAGGGCAGGGG + Intronic
962391346 3:134975307-134975329 GAGAGCCTTGGGCAGGGCAGGGG + Intronic
962396330 3:135018016-135018038 GAGAGCTCCAGGGAGGGCAGAGG + Intronic
963049123 3:141126929-141126951 GAGAGCCCGGGCTGGGGCATGGG - Intronic
967377736 3:188824522-188824544 GACAGCTCCGTGTAGGGCACTGG + Intronic
968510206 4:992256-992278 GAGGGCTCTGGTGTGGGCATGGG - Intronic
969608523 4:8214248-8214270 GTGAGCTCTGGGAAGGGCAGGGG + Intronic
972222012 4:36966685-36966707 CAGGGGTGTGGGTAGGGCATTGG - Intergenic
972338013 4:38125747-38125769 GAATGCCCTGGGTTGGGCATGGG + Intronic
973552992 4:52053642-52053664 GAGACCTGTGGTTGGGGCATGGG - Intronic
978876531 4:113646456-113646478 GGGAGTGCTGGGTGGGGCATGGG + Intronic
980701775 4:136441918-136441940 CACAGCTGTGGGGAGGGCATGGG + Intergenic
980943328 4:139295564-139295586 GAGAGCCCTGCGTAGGGGACAGG + Intronic
985000915 4:185481626-185481648 GAGAGCTCTGGATAAGGACTTGG - Intergenic
986693171 5:10330706-10330728 GAGAGCTCTGGGTGTGACAGAGG + Intergenic
988130030 5:27092110-27092132 GAGAGGGCTGGCTAGGGAATGGG - Intronic
988883201 5:35527769-35527791 GAGAGTGCTGGGTAGTGGATAGG + Intergenic
992212552 5:74495097-74495119 TAGGGCTCTGGGTAGGGGACAGG + Intergenic
992522503 5:77569469-77569491 GAGAGCTCTGGGTGGTTGATAGG - Intronic
1003435560 6:6084797-6084819 TAGAGCAGTGGGTAGGGGATGGG - Intergenic
1005582462 6:27247926-27247948 GAGAGCTCTGCCCAGGGCCTGGG + Exonic
1005661597 6:28003931-28003953 TAGATCTGGGGGTAGGGCATGGG + Intergenic
1006168471 6:32079689-32079711 GAGTGCCCTGGGGAGGGCACAGG - Intronic
1007931612 6:45696894-45696916 GAGAGGTATAGGGAGGGCATGGG + Intergenic
1012856495 6:104508052-104508074 GCTGGCTCTTGGTAGGGCATTGG + Intergenic
1013178062 6:107694075-107694097 GAGGCCTCTGGGTAGGAAATTGG + Intergenic
1013587354 6:111591394-111591416 GAGAGGTCTGGGGAGGTCCTGGG + Exonic
1016241490 6:141936528-141936550 AAGAGCCCTGGGAAGGGCAAAGG - Intergenic
1016401824 6:143689196-143689218 GAGAGCTGTGGGTGGGACCTGGG - Intronic
1017695288 6:157008729-157008751 GAGACCTCTGGGTACGGGATCGG + Intronic
1018152731 6:160955541-160955563 AAGAGCTCTGGGTAGGAAACAGG - Intergenic
1019472445 7:1228079-1228101 GGGAGCTCTGGGGAGTGCAGGGG + Intergenic
1022122022 7:27317598-27317620 GAGAACACAGGGTAAGGCATAGG - Intergenic
1022821198 7:33962593-33962615 GAGTCCCCTGGGTAGGGCTTAGG + Intronic
1024013955 7:45294356-45294378 GGGAGCACTGTGCAGGGCATGGG + Intergenic
1024064548 7:45721569-45721591 GTGAGCTATGGGAAGGCCATTGG + Exonic
1024309983 7:47960065-47960087 GAGAGCACAGGGTTGGGGATAGG - Intronic
1024945680 7:54805428-54805450 GGCAGCACTGGGCAGGGCATGGG - Intergenic
1025148673 7:56527257-56527279 GAGAGCTCAGGGTGGGACTTGGG + Intergenic
1026110241 7:67453670-67453692 AAAAGCTCTGGGTTGGGGATGGG + Intergenic
1026669003 7:72370757-72370779 GAGAGCTCTTGGCTGGGCATGGG + Intronic
1027052947 7:75031205-75031227 GGGGGCTCTGGGCAGGGCAGAGG - Intronic
1027229158 7:76262092-76262114 GGGAGCTCTGAGCAGGGCAGTGG + Intronic
1030111006 7:106026919-106026941 GAGGGCTCTAGGTAGGGCATAGG - Intronic
1030647175 7:112074743-112074765 GAGATCTCTGGGTAGAGGCTGGG - Intronic
1032013375 7:128360816-128360838 GAGAGTTCTGGGGAGGGGGTAGG - Intronic
1032088847 7:128900363-128900385 GAGAGCTCTGGTTGGGTCACAGG - Intronic
1033684658 7:143627264-143627286 GAGAGATTTGGGGAGGGGATGGG + Intronic
1033687834 7:143706483-143706505 GAGAGATTTGGGGAGGGGATGGG + Intronic
1033699953 7:143830359-143830381 GAGAGATTTGGGGAGGGGATGGG - Intergenic
1035065880 7:156104945-156104967 GAGCGCCCTGGGAAGGGCCTGGG - Intergenic
1035296401 7:157869229-157869251 GGGAGGTCTGGGTAGGGCCTTGG + Intronic
1040549481 8:48427515-48427537 CAGAGGACAGGGTAGGGCATGGG - Intergenic
1041612167 8:59863732-59863754 GTGAGCTTGGGGTAGAGCATGGG - Intergenic
1045892065 8:107169158-107169180 AAGAGCTCTTGGTGGGGCAGAGG - Intergenic
1048305086 8:133278500-133278522 TGGAGCTCTGGCCAGGGCATGGG + Intronic
1048438013 8:134435568-134435590 GAGAGCTTTGGGGAGGACAAAGG + Intergenic
1048802357 8:138206189-138206211 GAGAGCTGTGGGTAGTGAAGGGG - Intronic
1049650982 8:143769584-143769606 TAGAGCACTGGGTATGGCTTGGG - Intergenic
1049808787 8:144553905-144553927 TCGAGCTCTGTGTGGGGCATTGG - Intronic
1051148955 9:14060050-14060072 GAGGGCTCTGGTGAGGGCCTTGG + Intergenic
1051357840 9:16255682-16255704 AAGAGCTTTGTGTAGGGAATTGG - Intronic
1051359164 9:16266548-16266570 CAGAGTTCTGGGTATGGCTTTGG - Intronic
1055330117 9:75174872-75174894 GAGAGTGCTGGGTAGGGGCTGGG + Intergenic
1057440468 9:95079271-95079293 GAGAGATCTGGCTAGGTCAGTGG + Intronic
1059379876 9:113914721-113914743 GAGAGGGCTGGGTAGGGGAAGGG + Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1060594783 9:124841440-124841462 GAGAGCTCAGGGAAGAGCAAGGG - Intergenic
1061444952 9:130632404-130632426 GAGCCCTCTGGGTGGGGCTTGGG + Intronic
1062160903 9:135079201-135079223 GAGTGCTCTGGGTAGGAGTTGGG + Intronic
1185604274 X:1358735-1358757 GAGGGCTCTGGGAAGGCCTTCGG - Intronic
1186592310 X:10944031-10944053 GAGACCTCTGGGTTAGGCATAGG - Intergenic
1186596111 X:10983481-10983503 GAGAGATCTTGGTTGGGTATAGG - Intergenic
1189585878 X:42461231-42461253 GATAACTTGGGGTAGGGCATGGG - Intergenic
1190301037 X:49057743-49057765 CAGGGGTCTGGGTAGGGCTTGGG + Intronic
1195335315 X:103847776-103847798 GAAAGATGTGGGTAGGGTATAGG - Intergenic
1197051959 X:122070238-122070260 GAGAACTCTGGGAAGAGCAATGG + Intergenic
1198115336 X:133539510-133539532 AAGAGCTCTGGGTTGGAAATGGG + Intronic
1199399534 X:147381026-147381048 GATATCTCTGGGTGGGGCTTTGG - Intergenic
1200218009 X:154377144-154377166 GAGAGCCTTGGGTAGGGCAGGGG - Intergenic