ID: 1144660329

View in Genome Browser
Species Human (GRCh38)
Location 17:17063909-17063931
Sequence GTTGCCCAACTGCCCCAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144660329_1144660337 29 Left 1144660329 17:17063909-17063931 CCCGCTTGGGGCAGTTGGGCAAC 0: 1
1: 0
2: 0
3: 3
4: 117
Right 1144660337 17:17063961-17063983 GCATGCATCCCAGATTTGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 136
1144660329_1144660331 -4 Left 1144660329 17:17063909-17063931 CCCGCTTGGGGCAGTTGGGCAAC 0: 1
1: 0
2: 0
3: 3
4: 117
Right 1144660331 17:17063928-17063950 CAACCCAGAGTTGAGACAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 161
1144660329_1144660335 7 Left 1144660329 17:17063909-17063931 CCCGCTTGGGGCAGTTGGGCAAC 0: 1
1: 0
2: 0
3: 3
4: 117
Right 1144660335 17:17063939-17063961 TGAGACAGCTGGGTTCATCCTGG 0: 1
1: 0
2: 1
3: 12
4: 165
1144660329_1144660332 -3 Left 1144660329 17:17063909-17063931 CCCGCTTGGGGCAGTTGGGCAAC 0: 1
1: 0
2: 0
3: 3
4: 117
Right 1144660332 17:17063929-17063951 AACCCAGAGTTGAGACAGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 175
1144660329_1144660338 30 Left 1144660329 17:17063909-17063931 CCCGCTTGGGGCAGTTGGGCAAC 0: 1
1: 0
2: 0
3: 3
4: 117
Right 1144660338 17:17063962-17063984 CATGCATCCCAGATTTGCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144660329 Original CRISPR GTTGCCCAACTGCCCCAAGC GGG (reversed) Intronic
901304044 1:8219570-8219592 GTTTCAAAGCTGCCCCAAGCTGG + Intergenic
906580912 1:46934621-46934643 GCTGCCCAACTGCCCCAGTGTGG + Intronic
906602811 1:47144273-47144295 GCTGCCCAACTGCCCCAGTGTGG - Intronic
920584640 1:207145765-207145787 GTTGAGCAACTGCCCCACACAGG + Intergenic
922376887 1:224977915-224977937 GATGCCCAACATCCCCAATCAGG + Intronic
922966970 1:229698623-229698645 CTTGCCCAAAGGCCCCCAGCTGG + Intergenic
1063755861 10:9007568-9007590 GTTTCCCAGCTCACCCAAGCTGG - Intergenic
1067312473 10:45127016-45127038 GTTGCCCAGCTTGCCCAGGCTGG - Intergenic
1074190140 10:111128527-111128549 CTTGCCCCACTTTCCCAAGCTGG + Intergenic
1076114045 10:127882942-127882964 GCTGCCCATCTGCCCAGAGCAGG - Intronic
1077350828 11:2092500-2092522 GTCTCCCCACTGCCCCAGGCAGG - Intergenic
1077541793 11:3150147-3150169 GTTGCCCTCCTGCCCCAGGCAGG + Intronic
1078633543 11:13028285-13028307 GTTGCCCAAGTCACGCAAGCAGG - Intergenic
1083014631 11:59440433-59440455 GTTGCCCAACATCCCACAGCTGG + Intergenic
1085572716 11:77573189-77573211 TTTACCGAACTGCCCCATGCTGG + Intronic
1088036085 11:105318121-105318143 GATGCCCTCCTGGCCCAAGCGGG - Intergenic
1088746800 11:112810524-112810546 TTTGCCCTTCTGCCCCAGGCAGG - Intergenic
1089094312 11:115906185-115906207 GCTGCCCAGCTCCCCCAAACTGG + Intergenic
1091142899 11:133251319-133251341 GTAGCCTTAGTGCCCCAAGCAGG + Intronic
1094862934 12:34490714-34490736 GTTTCCCAACTGCTCCATCCAGG + Intergenic
1099805891 12:87518232-87518254 GTGGCCCAAATGGCCCTAGCTGG - Intergenic
1102245525 12:111353363-111353385 GTTGCCCAATGGCCCCCAGCTGG - Intergenic
1103201823 12:119093997-119094019 CTTGCCCAACTCAGCCAAGCAGG - Intronic
1106303565 13:28491045-28491067 CTTGCCCAACTGCCCAAGCCAGG + Intronic
1108360088 13:49661241-49661263 GATGCCAAACTGTGCCAAGCTGG - Intronic
1108604284 13:52021773-52021795 GATGCCCGACAGCCCCCAGCAGG - Intronic
1109415494 13:62034131-62034153 CTTGCCCAGCTGTCACAAGCAGG + Intergenic
1111412406 13:87894329-87894351 ATTGCCCAACTCTCCCAGGCAGG - Intergenic
1113520463 13:110936922-110936944 GTGGCCCACCTTCCGCAAGCAGG - Intergenic
1113671505 13:112178777-112178799 CTTTCACACCTGCCCCAAGCAGG + Intergenic
1113914132 13:113860937-113860959 CGTGTCCCACTGCCCCAAGCTGG - Intronic
1117646382 14:57857749-57857771 GCTTCCCAAATGCCCCAGGCTGG - Intronic
1121437096 14:93927341-93927363 GTTGCACAACTGCTTCCAGCCGG + Intronic
1121439350 14:93939099-93939121 GCTGCCCACCTGCACCACGCTGG + Exonic
1123921953 15:25076487-25076509 GTTGGCCTCCTGCCCTAAGCTGG + Intergenic
1125608693 15:40956805-40956827 CCTGCCCAGCTGCCCCAAGGAGG + Intergenic
1128374965 15:67067577-67067599 CCTGTACAACTGCCCCAAGCAGG - Intronic
1131112009 15:89770447-89770469 GTTGCCCAAGTTCTCCCAGCTGG + Intronic
1132731234 16:1363003-1363025 GTGGCCCAAGTGCTCCAAGTTGG - Exonic
1135135459 16:19883625-19883647 GCCGCCCAACTGCACCAGGCCGG - Intronic
1138622448 16:58222827-58222849 CTTGCACAACTTCCCCAGGCTGG - Intergenic
1140328608 16:74030238-74030260 CTGGCCCAAGTGCACCAAGCCGG - Intergenic
1143357238 17:6339402-6339424 GTTGAGCACCTGACCCAAGCTGG + Intergenic
1143582706 17:7835952-7835974 GTTCCCCACCTCCCCCCAGCTGG + Intergenic
1143728889 17:8868727-8868749 GTTGATCAACTTCCCCCAGCAGG - Intergenic
1144624244 17:16836693-16836715 GATGCACACCTGCCCCAAGGTGG + Intergenic
1144660329 17:17063909-17063931 GTTGCCCAACTGCCCCAAGCGGG - Intronic
1145063356 17:19745786-19745808 ATTGCCAAATTGCCCCCAGCAGG - Intronic
1146161982 17:30565003-30565025 GATGCACACCTGCCCCAAGGTGG + Intergenic
1147578381 17:41615415-41615437 GATGCACACCTGCCCCAAGGTGG + Intronic
1151625559 17:75273336-75273358 GCAGGCCAGCTGCCCCAAGCGGG - Exonic
1152449693 17:80369522-80369544 GTTGCACATCTGCCGGAAGCGGG - Exonic
1162291156 19:9781587-9781609 TTTGCCTAACTTCCACAAGCAGG - Intronic
1162725703 19:12688850-12688872 GCAGCCCCACAGCCCCAAGCAGG + Intronic
1164799602 19:31065300-31065322 CCTGCCCACCTGGCCCAAGCAGG - Intergenic
1164878045 19:31706662-31706684 ACAGCCCAACTGCCCCATGCTGG + Intergenic
1164932651 19:32187218-32187240 GTCCCCCCACTGCCCCAAGGAGG + Intergenic
1165258447 19:34594015-34594037 GTTCCCCACCTGCCCCAACAGGG - Intronic
926152385 2:10432397-10432419 GCTGCCAGGCTGCCCCAAGCCGG - Intergenic
927246142 2:20958415-20958437 GTTGTCCAACAGCCCCCGGCTGG - Intergenic
932231632 2:70088154-70088176 GCTGCCCAACTCCACCGAGCGGG + Exonic
933165748 2:79072658-79072680 ATTTCTCCACTGCCCCAAGCAGG - Intergenic
933170051 2:79115110-79115132 CATTCCCCACTGCCCCAAGCAGG + Intergenic
933172454 2:79138816-79138838 TTTGCCCCACTGCTCCAAACAGG - Intergenic
937244086 2:120481446-120481468 GCTGCCCACCTGCCCTTAGCAGG - Intergenic
938232436 2:129672767-129672789 GTTGCTCTACTGTCCCAAACAGG - Intergenic
940707872 2:157126659-157126681 GTTGCACTGCTGGCCCAAGCTGG - Intergenic
941698183 2:168575828-168575850 TCTGCCCACCTGCCCCAACCTGG + Intronic
942452956 2:176120021-176120043 CCTGCCCAAATGCCCCAAACAGG - Intergenic
946037175 2:216753512-216753534 CTTGCCCAAGATCCCCAAGCTGG + Intergenic
947096360 2:226571542-226571564 CATGCCCAACTGCAACAAGCTGG - Intergenic
948540732 2:238690037-238690059 TGTGGCCAACTGCCCCAGGCAGG - Intergenic
1180815709 22:18787946-18787968 GCTGCCCACCTGCCCAAAGGAGG + Intergenic
1181201897 22:21222281-21222303 GCTGCCCACCTGCCCAAAGGAGG + Intronic
1181699852 22:24614687-24614709 GCTGCCCACCTGCCCAAAGGAGG - Intronic
1183415539 22:37679665-37679687 GTTCCCCAACCGCCTCAACCTGG + Exonic
1183655882 22:39184443-39184465 GCTGCCCAAGCGTCCCAAGCAGG - Intergenic
1184678048 22:46054095-46054117 GCTGCCCGCCTGCCCCTAGCCGG + Exonic
1203225014 22_KI270731v1_random:73147-73169 GCTGCCCACCTGCCCAAAGGAGG - Intergenic
1203265814 22_KI270734v1_random:13637-13659 GCTGCCCACCTGCCCAAAGGAGG + Intergenic
949753292 3:7379286-7379308 GTTGCCCAGCTTGCCCATGCTGG + Intronic
953022640 3:39125511-39125533 CTTGCTCTTCTGCCCCAAGCAGG + Exonic
954004967 3:47583450-47583472 CTGGACCAACTGCCCCAAGAAGG + Intergenic
954957584 3:54535739-54535761 GCTGGCAAACTGGCCCAAGCTGG + Intronic
961683002 3:128611458-128611480 GTTACCCAGCTGGCACAAGCAGG + Intergenic
963025185 3:140912331-140912353 GGTGGTCAACTGCCCCTAGCAGG + Intergenic
966551323 3:181207344-181207366 GTTGGGCAAATGACCCAAGCTGG - Intergenic
968007816 3:195255044-195255066 TGTCCCCAACTGCCCCAGGCTGG + Intronic
969944643 4:10770833-10770855 GTTGTCCACCTACACCAAGCAGG + Intergenic
971734124 4:30424247-30424269 TTTGCCCCACAGCCCCCAGCAGG + Intergenic
972480078 4:39488462-39488484 TTTACCGAGCTGCCCCAAGCAGG + Intergenic
981749495 4:148080236-148080258 GTCCCACAAATGCCCCAAGCGGG + Exonic
982559315 4:156910149-156910171 GGTAACAAACTGCCCCAAGCAGG - Intronic
986064559 5:4222991-4223013 GCTGCCAATCTGCTCCAAGCCGG + Intergenic
989300922 5:39892855-39892877 CTTGTCCAAATGCCTCAAGCCGG + Intergenic
990948121 5:61270728-61270750 GATGCCTACCTGCCCCAAGCTGG - Intergenic
992373433 5:76168548-76168570 TTTGACCAAATGCCCCAAGATGG + Intronic
995107345 5:108389486-108389508 GTTGCCCACCTGCCTCAGGAGGG - Intergenic
997887163 5:137640199-137640221 GTTTCCCAAATGCCCCACTCGGG + Intronic
1002087688 5:176785982-176786004 GTGGCCCCACTGCCCCCTGCAGG - Intergenic
1002280870 5:178129475-178129497 GCTGCCCATCTGCCCTAAGGAGG - Intergenic
1002512697 5:179733118-179733140 GCTGCCCACCTGCCCCATGGCGG + Exonic
1004694516 6:18021180-18021202 GTTCCCCAACGGCCACAATCAGG - Intergenic
1006265454 6:32918411-32918433 TTTGCCCAATTGCCCCAGCCAGG + Intergenic
1019320297 7:412033-412055 GTTCTCCACCTGCCCCATGCTGG - Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1021891969 7:25194895-25194917 GCTGCTCCCCTGCCCCAAGCTGG - Intergenic
1024322986 7:48088553-48088575 GTGGCCGAACTGCCTCAAACCGG - Intergenic
1025049728 7:55724039-55724061 GGTGGACACCTGCCCCAAGCAGG + Intergenic
1035171630 7:157020706-157020728 GGTGCCCACCTGCCCCAGGAAGG - Intergenic
1037377789 8:18250710-18250732 GCTGCCCTCCTCCCCCAAGCTGG + Intergenic
1037499050 8:19468298-19468320 CTTGCCGAACTGCCTCAAGGTGG - Intronic
1043608261 8:82029109-82029131 ATTTCCCAACAGCCCAAAGCTGG - Intergenic
1052970600 9:34375081-34375103 GTTGCCCAACTGCTCCAGCTCGG + Intronic
1058135874 9:101307015-101307037 GAAGCCCACCTGCCCCATGCAGG - Intronic
1061941316 9:133885709-133885731 GATGCTCAGCTGCCCCAAGATGG + Intronic
1062278158 9:135740335-135740357 GCTCCCAAACTCCCCCAAGCAGG + Intronic
1191673094 X:63767177-63767199 CTAGCCAAACTGCACCAAGCTGG - Intronic
1199609534 X:149600928-149600950 GTTGCCAAAGTACCCCCAGCAGG - Intronic
1199629582 X:149768426-149768448 GTTGCCAAAGTACCCCCAGCAGG + Intergenic
1202095375 Y:21243917-21243939 TTTACCAAACTGCCCCAGGCTGG - Intergenic