ID: 1144663129

View in Genome Browser
Species Human (GRCh38)
Location 17:17084388-17084410
Sequence TTCGGGAGGAGCCATGTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144663125_1144663129 -2 Left 1144663125 17:17084367-17084389 CCTTTTCGCTCATCACAGAGATT 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1144663129 17:17084388-17084410 TTCGGGAGGAGCCATGTGCCCGG 0: 1
1: 0
2: 1
3: 6
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144663129 Original CRISPR TTCGGGAGGAGCCATGTGCC CGG Intronic
900509978 1:3054183-3054205 ATCTGCAGGAGCCATGTCCCTGG + Intergenic
900919003 1:5658971-5658993 TGCAGGAGGAGGCATGTCCCAGG - Intergenic
900950417 1:5855458-5855480 TGCGGGAGGCTCCATGTGGCTGG - Intergenic
902209464 1:14894246-14894268 TGCAGGAGGAGCCATCTGTCGGG - Intronic
902254272 1:15177425-15177447 GTCGGGAGGAACCAGGGGCCGGG + Intronic
903365869 1:22805140-22805162 TACGGGATGAGCCATGCACCCGG + Intronic
903502108 1:23806422-23806444 ATCAGGAGGAGGCATGTGGCGGG - Intronic
907932864 1:59016333-59016355 TTAGGGATGCGACATGTGCCAGG + Intergenic
909182960 1:72449056-72449078 TTCGGGAGGAGGCAAGTGCCAGG - Intergenic
920988272 1:210911204-210911226 TTTGGGAAGAGCCGTGGGCCAGG - Intronic
921196031 1:212759292-212759314 TTGTGGAGGAGGCAGGTGCCAGG - Intronic
1067391025 10:45864411-45864433 GTGGGGAGGAGCTATGTACCGGG - Intergenic
1067872255 10:49971694-49971716 GTGGGGAGGAGCTATGTACCGGG + Intronic
1069712355 10:70497849-70497871 ATAGGCGGGAGCCATGTGCCTGG + Intronic
1070138213 10:73714633-73714655 GTGGGGAGGAGCTATGTACCGGG - Intergenic
1070987493 10:80701051-80701073 CTTGGGAAGAGCCATGGGCCAGG + Intergenic
1072803280 10:98407936-98407958 TTCGAGAGGCGCCATGTGATCGG - Exonic
1074419720 10:113298312-113298334 TTCAGGAGGGGCCATGTCACTGG - Intergenic
1075225871 10:120628462-120628484 TTAGGCAGGCACCATGTGCCTGG - Intergenic
1075606879 10:123818061-123818083 TTCGGGAGGAGGTATGTGGATGG + Intronic
1076236561 10:128868131-128868153 CTCGGGAGCGGCCATTTGCCTGG + Intergenic
1076267187 10:129118136-129118158 TCCAGAAAGAGCCATGTGCCTGG + Intergenic
1076483192 10:130798231-130798253 TTGGGGAGGAGTCATGTCCCAGG + Intergenic
1076861647 10:133140731-133140753 TTGGGGAGGGGCCAGGTGCCTGG + Intergenic
1077011367 11:380724-380746 CTCGGGAGGGGTCAGGTGCCGGG - Intronic
1077461627 11:2713694-2713716 TGCAGGAGAAGCCAAGTGCCGGG + Intronic
1083814761 11:65126409-65126431 ATAGGCATGAGCCATGTGCCTGG + Exonic
1084556834 11:69880559-69880581 TTGGGGAGGAGGCAGGAGCCCGG - Intergenic
1087011535 11:93518797-93518819 TCCAGTAGGAGCCATGTGACTGG + Intronic
1088685212 11:112279444-112279466 TTCCTGGGGAGCCATGGGCCCGG - Intergenic
1091587855 12:1826513-1826535 TTCAGGAGGACCCACGTCCCTGG - Intronic
1092147560 12:6224908-6224930 TCAGGGAGGTGCCATGTGGCTGG - Intronic
1092315727 12:7411518-7411540 TGGGGGAGGTGCCAGGTGCCAGG - Intronic
1094190881 12:27697121-27697143 ATGGTGAGGAGCCATCTGCCAGG + Exonic
1102513995 12:113434497-113434519 TGCAGGAGGAGCCATTAGCCTGG - Intronic
1104178196 12:126352811-126352833 TGGGGGAGTAGACATGTGCCTGG - Intergenic
1104641270 12:130468869-130468891 GACGGGAAGAGCCATGTGTCTGG + Intronic
1105212311 13:18264402-18264424 CTCGGGTGGAGCCAGGTGCTGGG - Intergenic
1106413509 13:29527013-29527035 TTCAGGAGGACCCGGGTGCCGGG + Intronic
1110817136 13:79874554-79874576 ATCGGGTGGTGCCATCTGCCTGG - Intergenic
1112309835 13:98308531-98308553 GTCTGGAGGAGCCATGTCTCAGG - Intronic
1118674927 14:68173707-68173729 TTAGGGAGTACCCATGTTCCTGG + Intronic
1118751334 14:68809735-68809757 TTGAGCAGGAGCCCTGTGCCAGG + Intergenic
1122238564 14:100346666-100346688 TTCTGGAGGAGACACATGCCTGG - Intronic
1122767290 14:104081290-104081312 TTGGGGAGGTGCCAGGTGGCAGG - Intergenic
1122888491 14:104722150-104722172 TTCGGGCTGAGCCGTGTGACTGG + Intronic
1122940556 14:104979128-104979150 TTAGGGGTGAGACATGTGCCAGG + Intergenic
1126677302 15:51171627-51171649 ATCAGGAGGAGGCATTTGCCAGG + Intergenic
1126775126 15:52093961-52093983 TTTCGCAGGCGCCATGTGCCAGG + Intergenic
1128791973 15:70440382-70440404 TGAGGGAAGAGCCATGTGCAGGG - Intergenic
1128818234 15:70629757-70629779 TGCGGCTGGAGTCATGTGCCAGG - Intergenic
1129465262 15:75721278-75721300 TTCGGGTGGAGCAGTGGGCCTGG + Intergenic
1137670391 16:50275035-50275057 TTCGACAGGAGCCCTTTGCCGGG + Intronic
1138127120 16:54448053-54448075 TTTGGGAGGAGCTGGGTGCCAGG + Intergenic
1140067414 16:71623556-71623578 TAGGGGAAGAGCCATGTGTCTGG + Intergenic
1143480911 17:7226892-7226914 TGCTGGACAAGCCATGTGCCAGG - Intronic
1144167876 17:12630110-12630132 TATGGGAGGAACTATGTGCCAGG + Intergenic
1144663129 17:17084388-17084410 TTCGGGAGGAGCCATGTGCCCGG + Intronic
1150623892 17:66829197-66829219 TTGGGGAGGTGGCATGAGCCTGG + Intergenic
1152514716 17:80816605-80816627 TAAGGGAGGAGCCGGGTGCCAGG + Intronic
1152861250 17:82698100-82698122 GTCGGGAGGAGCCCAGCGCCCGG + Intronic
1157411078 18:47464098-47464120 TTCAGAAGCTGCCATGTGCCAGG - Intergenic
1157610046 18:48950366-48950388 CTCTGGAGGAGCCGTGCGCCCGG - Exonic
1160904541 19:1446143-1446165 TTCGGGAGGAGCCCCGCCCCGGG + Intergenic
1162791483 19:13065278-13065300 TTGGGCAGGAGCCATTGGCCTGG - Intronic
1165005332 19:32800950-32800972 CTGGGGAGGAGCCAGGTGCGGGG + Intronic
1165211775 19:34241635-34241657 TGCGGGAGGAGCCACCTGCCTGG + Intergenic
925035770 2:684467-684489 TTAGGCATGTGCCATGTGCCTGG - Intergenic
928391306 2:30912942-30912964 TTCAGGAGGGTGCATGTGCCAGG + Intronic
929857887 2:45651384-45651406 ATCGGGAGGCGCCAGGAGCCCGG - Intronic
933492046 2:82997726-82997748 TTAGGCAGGGGCCATTTGCCAGG - Intergenic
935216174 2:100976867-100976889 TTCTGGATCAGCCCTGTGCCTGG + Intronic
938525833 2:132129889-132129911 TGCGGGAGGGGGTATGTGCCAGG - Intergenic
948596484 2:239082694-239082716 TTCGGCAGGAGACAAGTCCCAGG + Intronic
948919966 2:241060664-241060686 ATAGGCATGAGCCATGTGCCCGG - Intronic
949017551 2:241721989-241722011 GTCGGAAGGGGCCCTGTGCCAGG + Intronic
1171119691 20:22557799-22557821 CTTGGGAGGCACCATGTGCCTGG - Intergenic
1173728253 20:45311784-45311806 CTCGGGAGGACGCAGGTGCCAGG - Intronic
1174000129 20:47368573-47368595 TTATTGAGGTGCCATGTGCCAGG + Intergenic
1175247113 20:57588875-57588897 TTAGCGTGGAGCCCTGTGCCTGG + Intergenic
1180815128 22:18784721-18784743 CTCGGGTGGAGCCAGGTGCTGGG - Intergenic
1181041113 22:20193043-20193065 TGTGGGAGGAGGCATGTGGCGGG + Intergenic
1181201318 22:21219058-21219080 CTCGGGTGGAGCCAGGTGCTGGG - Intronic
1181700431 22:24617905-24617927 CTCGGGTGGAGCCAGGTGCTGGG + Intronic
1183189887 22:36315339-36315361 TTTGAGAGGAGCCATGAGCTGGG - Intronic
1184550391 22:45201325-45201347 TTCAGGAGGAGGGATGTGCTAGG - Intronic
1184675527 22:46040685-46040707 GTCGGGAAGAGCCCTGTCCCTGG + Intergenic
1203225596 22_KI270731v1_random:76372-76394 CTCGGGTGGAGCCAGGTGCTGGG + Intergenic
1203265234 22_KI270734v1_random:10412-10434 CTCGGGTGGAGCCAGGTGCTGGG - Intergenic
949408888 3:3742516-3742538 ATTGGGACCAGCCATGTGCCAGG - Intronic
955755967 3:62225377-62225399 TGGGAGAGGAGCTATGTGCCCGG + Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
960702742 3:120452714-120452736 TTGGGGAGCAGGCATGTCCCAGG - Intergenic
961562226 3:127738545-127738567 CTGGGCAGGAGCCATCTGCCAGG + Intronic
961603136 3:128076051-128076073 CCAGGGAGGAGCCGTGTGCCAGG - Intronic
962068704 3:132010885-132010907 ATCAGGAAAAGCCATGTGCCAGG - Intronic
963785328 3:149528673-149528695 GGCAGGAGGAGCCCTGTGCCTGG + Intronic
968615095 4:1574181-1574203 TCAGGGAAGAGCCACGTGCCAGG - Intergenic
969296375 4:6272500-6272522 TTGAGGAGCAGCCCTGTGCCAGG + Intronic
969309560 4:6345588-6345610 TGGGGGAGGGGCCACGTGCCAGG + Intronic
970488099 4:16544544-16544566 AGCTGGAGGAGCCATGTTCCTGG + Intronic
980387860 4:132110551-132110573 TTGGGGAAGAGCTATGTGCATGG - Intergenic
982327505 4:154143983-154144005 ATAGGGAGGAAGCATGTGCCTGG - Intergenic
983458817 4:168001102-168001124 TTCTGGAGGAGTCATGCACCTGG + Intergenic
984019288 4:174465586-174465608 TTTGGGAGGAGGGATGTTCCAGG - Intergenic
989109116 5:37890108-37890130 TTAGGGAAGGGCCATGTGACAGG + Intergenic
990408283 5:55514100-55514122 ATAGGCATGAGCCATGTGCCTGG - Intronic
993089117 5:83401683-83401705 GTTGGCAGAAGCCATGTGCCTGG - Intergenic
994723209 5:103404037-103404059 TTAGGGAGGATGCATGAGCCAGG + Intergenic
1001511827 5:172328709-172328731 TGTGGGAGGAGGCCTGTGCCTGG - Intronic
1001538047 5:172513529-172513551 TTTGGGGGCAGCCATTTGCCCGG - Intergenic
1003502477 6:6713853-6713875 TTCAGCAGAAGCGATGTGCCAGG + Intergenic
1004780652 6:18904734-18904756 TTGGGGAGCAGCCACATGCCAGG - Intergenic
1006411421 6:33876144-33876166 TTTAGAAGGAGCCATGTGCCTGG - Intergenic
1007625485 6:43243929-43243951 GTGGGGAGGAGCAAAGTGCCCGG - Intronic
1011295789 6:85825988-85826010 TTGTGGAGGAGGCAAGTGCCAGG - Intergenic
1012430085 6:99154951-99154973 TTAAGGAGCAGCCATGTGCCAGG + Intergenic
1019405731 7:882944-882966 TGCAGGAGGAGCCAAGTGGCAGG - Intronic
1019797613 7:3063390-3063412 TTCGGGAGGAGTGAGGTGTCAGG + Intergenic
1026012184 7:66645036-66645058 TTCAGGGGATGCCATGTGCCTGG + Intronic
1030619672 7:111775293-111775315 TTGGGGAGGAGCCATGATTCAGG + Intronic
1034385495 7:150737526-150737548 TTAAGGAGGAGCCATGTGCTGGG - Exonic
1035096901 7:156363190-156363212 TTCAGGAGAGGCCATGTGGCAGG - Intergenic
1036850042 8:12194635-12194657 TTGGGGAGGGGCCCAGTGCCCGG + Intergenic
1037594270 8:20341670-20341692 TGCTGGAGGACCCATGGGCCAGG + Intergenic
1043518975 8:81024389-81024411 TCCTGGAGGGGCCGTGTGCCAGG - Intronic
1043683039 8:83055339-83055361 TTGTGGAGGAGACAAGTGCCAGG + Intergenic
1047365247 8:124205308-124205330 TGAGGAAGGAGCCATGAGCCAGG + Intergenic
1049061795 8:140281932-140281954 TGCGGGAGGTCCCATGTGCTGGG - Intronic
1049283722 8:141763368-141763390 GGCGGGAGGAGCCATGAACCTGG - Intergenic
1049318042 8:141980107-141980129 TCCAGGAGGAGCCTGGTGCCAGG - Intergenic
1049524126 8:143112347-143112369 TTCGAGATGAGCCATGGGACTGG - Intergenic
1053411241 9:37917427-37917449 TTTCTGAGGAGCAATGTGCCCGG + Intronic
1054205123 9:62123786-62123808 TTCGGAAGGAGGGATGTTCCAGG - Intergenic
1059393511 9:114016365-114016387 CTGGGGTGGAGCGATGTGCCAGG + Intronic
1060274610 9:122172960-122172982 TTCGGGAGGAGTGATTTGCAAGG - Intronic
1060407488 9:123379994-123380016 CCCAGGAAGAGCCATGTGCCAGG + Exonic
1061973686 9:134057846-134057868 TTCTGGAGGGGCCTTGTGGCTGG - Intronic
1062057843 9:134477787-134477809 TTCGGGTGTGCCCATGTGCCGGG + Intergenic
1062084938 9:134643574-134643596 TGGGGGAGGAGCCAGGAGCCTGG + Intronic
1187045673 X:15646250-15646272 TGCACGAGGCGCCATGTGCCGGG - Intronic
1192698477 X:73443534-73443556 TTTGGGAGAATCCAAGTGCCTGG - Intergenic
1199496630 X:148459401-148459423 TTGAGGAGCAGCCATGTGACTGG - Intergenic