ID: 1144665117

View in Genome Browser
Species Human (GRCh38)
Location 17:17097090-17097112
Sequence CAGGATCAGCCAAAGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 502}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144665117 Original CRISPR CAGGATCAGCCAAAGCAGAG GGG Intronic
900038953 1:441078-441100 GAGGGTGAGCCAAAGCAGAATGG + Intergenic
900060385 1:676054-676076 GAGGGTGAGCCAAAGCAGAATGG + Intergenic
900189610 1:1347840-1347862 CACGACCAGGCAAAGCAGAGAGG - Intronic
900227891 1:1541196-1541218 CAGGGACAGCCACAGCGGAGTGG - Intergenic
901219763 1:7576846-7576868 CAGGATCCACCAGAGCAGAGAGG + Intronic
901936616 1:12631087-12631109 CAAGATCAGCCAGAGCTGAGCGG + Intergenic
902938269 1:19780479-19780501 CACGATGAGGCAATGCAGAGAGG - Intronic
902965213 1:19996072-19996094 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
903673714 1:25051607-25051629 CAGAGACAGCCAAAGGAGAGGGG + Intergenic
904054968 1:27663966-27663988 CAGGATCTGACAAGGCTGAGGGG + Intergenic
904360122 1:29965733-29965755 CAGGAGCAGCCCCAGCAGGGTGG + Intergenic
904481788 1:30798569-30798591 CATCATCAGCCAGAGCTGAGTGG + Intergenic
905258274 1:36699729-36699751 CAGGAGTAGGCAAAGAAGAGAGG - Intergenic
905879726 1:41455710-41455732 CAGCATCAGCAAAGGCACAGTGG - Intergenic
906278169 1:44533821-44533843 CAGAATGAGCAAAAGCAGAGAGG + Intronic
906520539 1:46464461-46464483 CACTATCAGCCAAGGCAGAAGGG - Intergenic
906919023 1:50043539-50043561 CAGGAGCATCCAAAGCAGCTTGG - Intergenic
907015099 1:51005082-51005104 GAGGGTAAGCCAAAGCAGGGTGG + Intergenic
907078329 1:51598006-51598028 CAAGAACAGCAAAAGCACAGAGG + Intronic
907087392 1:51688429-51688451 CAAGACCAGCCTAAGCAAAGAGG + Intronic
907519480 1:55013867-55013889 CAGCATGAGCCAAGGCAGGGTGG - Intergenic
907811295 1:57872884-57872906 AAGGCTGAGCCAAAGCAGGGTGG + Intronic
908840194 1:68272412-68272434 CAGGGTCAGCCTAAGAGGAGAGG - Intergenic
909470989 1:76027878-76027900 AAGGAGAAGCCAAATCAGAGTGG + Intergenic
911689766 1:100820102-100820124 GAGGGTGAGCCAAAGCAGGGCGG + Intergenic
911692136 1:100845932-100845954 GAGGGCCAGCCAAAGCAGGGTGG - Intergenic
912636155 1:111295731-111295753 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
912914245 1:113796272-113796294 CAGGAGCAGCCAATGTGGAGAGG - Intronic
912962778 1:114210773-114210795 CAGGACCACCCTAAGCAAAGTGG + Intergenic
913607359 1:120478307-120478329 GAGGATGAGCCAAAGCAGGGTGG + Intergenic
914197002 1:145452749-145452771 CAGGAGCAGGCAGAGCAGATGGG + Intergenic
914209074 1:145561832-145561854 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
914267993 1:146054198-146054220 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
914369101 1:147006661-147006683 GAGGATGAGCCAAAGCAGGGTGG + Intergenic
914458691 1:147861777-147861799 GAGGGTGAGCCAAAGAAGAGTGG + Intergenic
914583835 1:149043527-149043549 GAGGATGAGCCAAAGCAGGGTGG - Intronic
915771858 1:158433341-158433363 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
916204108 1:162298482-162298504 GAGGATCAGCAGAGGCAGAGTGG + Intronic
916469559 1:165109539-165109561 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
917041550 1:170810893-170810915 GAGGGTGAGCCAAAGCAGGGCGG + Intergenic
917192377 1:172431760-172431782 GAGGGTGAGCCAAAGCAGGGCGG + Intronic
917585058 1:176417440-176417462 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
918537143 1:185586549-185586571 GAGGGTGAGCCAAAGCAGAGTGG + Intergenic
918784701 1:188750489-188750511 AGGAATGAGCCAAAGCAGAGAGG - Intergenic
918832562 1:189416494-189416516 GAGGGCCAGCCAAAGCAGGGTGG - Intergenic
919400688 1:197112693-197112715 CAGGAAGACCCAAAGCAGGGAGG - Intronic
919620824 1:199862837-199862859 CAGGAGTAGCCACAGCAGAATGG + Intergenic
920087109 1:203425545-203425567 CAGGATCATGCAGAGCAGACAGG + Intergenic
920397842 1:205659663-205659685 CAGGAACACCTAAGGCAGAGGGG + Exonic
921358146 1:214305754-214305776 CAGGAGCAGCCAGGGCTGAGGGG + Intronic
923033669 1:230268986-230269008 AAGGAAAAGCAAAAGCAGAGTGG - Intronic
923194501 1:231652061-231652083 CAGGGTGAGCCGAAGCAGGGCGG - Intronic
924335176 1:242980377-242980399 CAGGAACAGCCTCAGCATAGGGG + Intergenic
924379244 1:243446626-243446648 CAGGAACAGAGAAAGCAGAAAGG - Intronic
1064745563 10:18475094-18475116 CAGGAACAGCCAGAGGAGAGAGG + Intronic
1065588362 10:27241441-27241463 GAGGAGCAGCCGAAGGAGAGAGG + Intronic
1065794897 10:29297558-29297580 CAGTATGAGACAAAGCAGAATGG - Intronic
1066111818 10:32204147-32204169 AAAGATGAGGCAAAGCAGAGAGG + Intergenic
1066365452 10:34771892-34771914 CAGGATAAGCCAATGAAGATGGG + Intronic
1067231167 10:44411691-44411713 GAGGGCCAGCCAAAGCAGGGCGG - Intergenic
1067521607 10:47011744-47011766 CAGGAAGAGCTAAAGGAGAGAGG - Intergenic
1067695932 10:48535706-48535728 CAGTTTCAGTCAAAGCAGTGTGG - Intronic
1068316125 10:55344866-55344888 CTGGGTCTGCCAGAGCAGAGAGG + Intronic
1068622926 10:59207273-59207295 GAGGGCCAGCCAAAGCAGGGTGG + Intronic
1068651560 10:59528342-59528364 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1068789200 10:61008873-61008895 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1069349056 10:67503263-67503285 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1069674197 10:70235656-70235678 CAGGGTCACCCACAGCAAAGGGG - Intergenic
1070064646 10:73021661-73021683 GAGAATGAGCCAAAGCAGGGCGG + Intronic
1070533665 10:77359455-77359477 CAGCCTCAGCCCAACCAGAGCGG + Intronic
1071047745 10:81403554-81403576 CAAGATCAGTCAAAGGTGAGTGG + Intergenic
1071844275 10:89505596-89505618 GAGGGTGAGCCGAAGCAGAGTGG + Intronic
1071884768 10:89937487-89937509 GAGTGTGAGCCAAAGCAGAGCGG - Intergenic
1071957102 10:90770999-90771021 CAGGCTCAGCCAGAGCAGAAGGG + Intronic
1072287247 10:93927842-93927864 GAGCATGAGCCAAAGCAGGGTGG + Intronic
1072747210 10:97949230-97949252 AAGGATCAGCCACCTCAGAGGGG + Intronic
1073286729 10:102394220-102394242 TAGGCGCAGCCAAAGCCGAGAGG + Intronic
1073478257 10:103768503-103768525 CAGGATGGGCCAGAGCACAGAGG + Intronic
1074017248 10:109546441-109546463 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1074985257 10:118652574-118652596 GAGGACAAGCCAAAGCAGGGTGG - Intergenic
1076965162 11:76989-77011 GAGGGTGAGCCAAAGCAGAATGG + Intergenic
1077655723 11:4017044-4017066 GAGGACAAGCCAAAGCAGGGTGG - Intronic
1077995314 11:7447449-7447471 CAGCATGAGCAAAAGCAAAGTGG - Intronic
1078392987 11:10952555-10952577 GAGGGTCAGCCGAAGCAGGGTGG - Intergenic
1078686273 11:13534965-13534987 GAGGGACAGCCAAAGCAGGGTGG - Intergenic
1079262616 11:18897830-18897852 GAGGACAAGCCAAAGCAGGGTGG - Intergenic
1079517789 11:21289357-21289379 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1080031417 11:27665443-27665465 GAGCATGAGCCAAAGCAGGGTGG + Intronic
1080033697 11:27688705-27688727 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1080397039 11:31899612-31899634 GAGAATAAGCCAAAGAAGAGTGG - Intronic
1080855603 11:36109115-36109137 TAGAATCAGACAATGCAGAGAGG + Intronic
1081891764 11:46548703-46548725 AAGGATCAGGCCAAGCACAGTGG + Intronic
1082830928 11:57616649-57616671 CAGGATCTCCCCAAGGAGAGGGG - Intergenic
1083395919 11:62391889-62391911 TAGCATCAGCCTGAGCAGAGGGG - Intronic
1084970372 11:72768248-72768270 CAGGAGCAGAAAGAGCAGAGGGG - Intronic
1085433718 11:76480762-76480784 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1085450711 11:76630416-76630438 CAGGAACAGCAAATGCAGAGAGG - Intergenic
1085735231 11:79032963-79032985 CAGGCTCAGCCAGAGAAGTGGGG + Intronic
1085746985 11:79123417-79123439 AAGGGGCAGCCAAAGCAAAGTGG - Intronic
1085827575 11:79864549-79864571 GAGGGTGAGCCAAAGCAGGGAGG + Intergenic
1085884369 11:80505397-80505419 GAGGATGAGCCAAAGCAGGGTGG + Intergenic
1086612913 11:88778425-88778447 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1087082655 11:94186858-94186880 CAGCATCCGAGAAAGCAGAGAGG - Intergenic
1087712096 11:101566727-101566749 GAGGGCCAGCCAAAGCAGGGTGG + Intronic
1087994608 11:104788546-104788568 CAAGATCAGCTCCAGCAGAGAGG + Intergenic
1088795610 11:113264650-113264672 CAGGACCACCCACAGGAGAGGGG + Intronic
1089729156 11:120509992-120510014 CAAGATCAGCGAGACCAGAGAGG - Intergenic
1090103822 11:123830192-123830214 CAGGGCGAGCCAAAGCAGGGCGG - Intergenic
1090280341 11:125450594-125450616 GAGGATCTGCCAAAAAAGAGAGG + Intronic
1090534081 11:127621317-127621339 CAGTATGAGAGAAAGCAGAGAGG - Intergenic
1093677592 12:21962348-21962370 GAGGGTGAGCCAAAGCAGGGCGG + Intergenic
1094482372 12:30895021-30895043 GAGGGCAAGCCAAAGCAGAGTGG - Intergenic
1096044944 12:48554166-48554188 GAGCATGAGCCAAAGCAGGGTGG - Intergenic
1096219485 12:49820126-49820148 CAGGAGGAACCAAGGCAGAGAGG + Intronic
1096320444 12:50607651-50607673 TATAATCAGCAAAAGCAGAGTGG + Intronic
1097364892 12:58701475-58701497 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1097365767 12:58710341-58710363 GAGGGTGAGCCAAAGCAGGGCGG - Intronic
1097635279 12:62114286-62114308 GAGGACGAGCCAAAGCAGGGTGG - Intronic
1097980748 12:65735808-65735830 CAGCATATGCCAAAGCACAGAGG + Intergenic
1098176073 12:67792603-67792625 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1098438866 12:70497491-70497513 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1098638553 12:72813533-72813555 GAGCATGAGCCAAAGCAGGGCGG - Intergenic
1098874319 12:75851084-75851106 CAGTATCAGCCAGAGAGGAGAGG - Intergenic
1098906726 12:76170147-76170169 GAGGATGAGCCAAAGTAGAGTGG - Intergenic
1099022610 12:77424846-77424868 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
1099183841 12:79497156-79497178 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1099554694 12:84097277-84097299 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1099740332 12:86626890-86626912 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1099806853 12:87531128-87531150 GAGCATGAGCCAAAGCAGGGTGG + Intergenic
1100089630 12:90954375-90954397 GAGCAGCAGCAAAAGCAGAGAGG + Exonic
1100492061 12:95090231-95090253 CAGCATGAGCAAAGGCAGAGAGG + Intronic
1101100145 12:101383234-101383256 CTGGATCAACCACAGCAGCGTGG - Exonic
1101403891 12:104411655-104411677 CAGGTGCAGCGAAAGCAGAAAGG - Intergenic
1101432805 12:104640968-104640990 CAGGCTCAGCCAACAGAGAGGGG + Intronic
1102941183 12:116943636-116943658 CAGGGTCAGCCAGAGGGGAGAGG + Intronic
1103032602 12:117629173-117629195 GAGGGTGAGCCAAAGCAGTGCGG - Intronic
1103203662 12:119110790-119110812 GAGCATGAGCCAAAGCAGGGCGG - Intronic
1103280510 12:119754400-119754422 CACCATCAGTCACAGCAGAGTGG + Intronic
1105013308 12:132770380-132770402 CAGGCCCTGCCAAACCAGAGGGG + Exonic
1105737463 13:23285904-23285926 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1106250877 13:27980635-27980657 GAGGATCAGCCCAAGCTGCGAGG + Intronic
1106326389 13:28694178-28694200 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1106426676 13:29636955-29636977 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1107722137 13:43259836-43259858 GAGGAGCAGACAAAGCAGAAAGG - Intronic
1108988720 13:56628846-56628868 GAGGGTGAGCCAAAGCAGTGCGG + Intergenic
1108998236 13:56762990-56763012 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1109122177 13:58471207-58471229 AAGGAACAGCAACAGCAGAGGGG + Intergenic
1110712262 13:78663429-78663451 CAGGAACCACCAAGGCAGAGAGG + Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1113348833 13:109508280-109508302 GAGGGTGAGCCAAAGCAGGGCGG - Intergenic
1113523525 13:110956662-110956684 CAGGCTCAGCCAAACCAGCACGG + Intergenic
1113701741 13:112393573-112393595 CAGGCTCAGCCAAACCAGCACGG - Intronic
1114133643 14:19821224-19821246 GAGGGTAAGCCAAAGCAGGGTGG - Intronic
1114931930 14:27482271-27482293 CAGTTTCAGCAAAAGCACAGAGG + Intergenic
1115082475 14:29473544-29473566 CAGGGTCAGCCAGAGATGAGAGG + Intergenic
1115277153 14:31621584-31621606 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1115511184 14:34139486-34139508 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1115537968 14:34391353-34391375 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1115584555 14:34797828-34797850 CAGGGCGAGCCAAAGCAGGGCGG + Intronic
1115743172 14:36409562-36409584 GAGGGTGAGCCAAAGCAGGGAGG + Intergenic
1115954590 14:38764196-38764218 GAGTGTGAGCCAAAGCAGAGAGG + Intergenic
1116511964 14:45757051-45757073 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1116775639 14:49178319-49178341 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1120039890 14:79740279-79740301 ATGGAGCAGCTAAAGCAGAGTGG - Intronic
1120201229 14:81540362-81540384 GAGGGTAAGCCAAAGCAGACTGG + Intergenic
1120462356 14:84813495-84813517 CTGGATCAACCAGAGCACAGTGG - Intergenic
1122744082 14:103887789-103887811 CAGGCTCAGCCCGAGCTGAGGGG - Intergenic
1123048609 14:105530201-105530223 CAGGAACAGGCAAAGCAGTGCGG - Exonic
1123576718 15:21676792-21676814 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
1123613340 15:22119260-22119282 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
1124532904 15:30522159-30522181 CTGGATAAGCCAGAGCTGAGGGG - Intergenic
1124765752 15:32485485-32485507 CTGGATAAGCCAGAGCTGAGGGG + Intergenic
1124789044 15:32709391-32709413 CTGCATCAGCCAGAGCAGACAGG - Intergenic
1124885666 15:33683655-33683677 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1124948451 15:34292986-34293008 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1125288432 15:38119567-38119589 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1125752395 15:42037343-42037365 TGGGCTCAGCCAGAGCAGAGCGG + Intronic
1126050750 15:44682937-44682959 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1126476280 15:49068697-49068719 GAGGGTGAGCCAAAGCAGGGCGG + Intergenic
1127311022 15:57752551-57752573 CAGGTTCATCCACAGCAGAGGGG + Intronic
1131472320 15:92708069-92708091 CAGGAACTGGGAAAGCAGAGGGG - Intronic
1131683480 15:94747847-94747869 CAGAAGCACCCAAAGAAGAGAGG + Intergenic
1132442965 15:101886529-101886551 GAGGGTGAGCCAAAGCAGAATGG - Intergenic
1202985586 15_KI270727v1_random:411037-411059 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
1132708882 16:1257880-1257902 CAGGACCAGCCTCAGCGGAGGGG + Intronic
1133721447 16:8498239-8498261 CATGATCTGCAGAAGCAGAGCGG - Intergenic
1136600603 16:31284690-31284712 GAGTATGAGCCAAAGCAGGGTGG - Intronic
1137417939 16:48302462-48302484 CAGGTCCATCCAAAGCTGAGTGG + Intronic
1138143659 16:54589332-54589354 CAGCATCAGCCTAAGCATAGTGG - Intergenic
1139405263 16:66712829-66712851 CAGTATTAGCCCAAGCAGGGTGG - Intergenic
1139612885 16:68071503-68071525 CAGGAGCAGCCACAGCCAAGAGG + Intronic
1140533153 16:75684192-75684214 AAGAATCAGCTAAAGCAGAGGGG + Intronic
1140619842 16:76716708-76716730 CAGCATCAGCTATAGCAGTGTGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142315208 16:89339794-89339816 GAGGAGCAGCCACAGCAGGGTGG - Intronic
1143171825 17:4934723-4934745 CAGTCCCAGCCAAAGCAGAAGGG + Exonic
1143330946 17:6135329-6135351 CAGGAATAGCCAGAGAAGAGTGG - Intergenic
1143345001 17:6242923-6242945 CAGGATCAGCCCAAGAAGCCGGG + Intergenic
1144503385 17:15808486-15808508 CAGGATGAGCCAAGGCCTAGTGG + Intergenic
1144665117 17:17097090-17097112 CAGGATCAGCCAAAGCAGAGGGG + Intronic
1144743419 17:17597112-17597134 CAAGATCACCCAACTCAGAGTGG - Intergenic
1145165564 17:20611193-20611215 CAGGATGAGCCAAGGCCTAGTGG + Intergenic
1147135269 17:38430409-38430431 CAGGGTCAGCCCGAGGAGAGGGG - Intronic
1147712021 17:42474460-42474482 CAAGAACAGGCAAGGCAGAGAGG - Intronic
1148440796 17:47710792-47710814 CAGGAAGAGCCAGAGCTGAGTGG - Exonic
1148780642 17:50119437-50119459 CAGGAGCAGACAAGGCAGGGTGG - Intronic
1148967293 17:51446817-51446839 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1149561640 17:57611732-57611754 CAGGCCCAGCCAAACCAGTGTGG + Intronic
1151518197 17:74610874-74610896 CAGCATAAGTGAAAGCAGAGAGG - Exonic
1151783691 17:76265089-76265111 CCGGATGAGCCAAAACACAGCGG + Intergenic
1155526646 18:26722362-26722384 CAGGATAAGCCACTGCAGTGGGG + Intergenic
1156232299 18:35165542-35165564 CAGGATCAGGCCAGGCACAGTGG + Intergenic
1156434420 18:37111698-37111720 GAGTATGAGCCAAAGCAGGGTGG + Intronic
1156979368 18:43266070-43266092 CAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1157687730 18:49656271-49656293 CAGGATCTACCGAAACAGAGTGG - Intergenic
1157695190 18:49716748-49716770 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1157889937 18:51406068-51406090 CAGGATCAGATAAAGCAGTGTGG + Intergenic
1158104957 18:53875116-53875138 CACAATCATCCAAATCAGAGTGG + Intergenic
1158122034 18:54059091-54059113 CAGAAACAGCCACAGCAGAATGG + Intergenic
1158367258 18:56751484-56751506 CAGCATCTGCCAAAGCACTGTGG + Intronic
1158388171 18:57018510-57018532 CAGCATCAGCCAGGGCTGAGTGG - Intronic
1158549364 18:58422128-58422150 CCGGATCAGCCATAGAAAAGTGG - Intergenic
1158703661 18:59771504-59771526 GATGGTGAGCCAAAGCAGAGTGG + Intergenic
1159087464 18:63809906-63809928 CATCACCAGCCAGAGCAGAGGGG + Intergenic
1159922470 18:74238213-74238235 GGGGAGCAGCCCAAGCAGAGGGG + Intergenic
1160121405 18:76133615-76133637 CAAGGTCAGCCAAAGGTGAGTGG + Intergenic
1160641967 19:146619-146641 GAGGGTGAGCCAAAGCAGAATGG + Intergenic
1161296314 19:3522349-3522371 CAGGCTCAGCCAAACCAGGAAGG - Intronic
1163939969 19:20482587-20482609 GAGGCAGAGCCAAAGCAGAGTGG + Intergenic
1164447031 19:28326548-28326570 CATGATCAGCTACTGCAGAGAGG - Intergenic
1164660702 19:29964229-29964251 CAAGAGCTGCCAAAGCAGTGAGG - Intronic
1166233029 19:41436767-41436789 CATGACCAAACAAAGCAGAGAGG + Intronic
1167925853 19:52820618-52820640 CCGGGTCAGACAGAGCAGAGTGG - Intronic
1167930039 19:52856607-52856629 CCGGGTCAGACAGAGCAGAGTGG - Intronic
1168232599 19:55042706-55042728 CAGGTTCAGCCCAAGAGGAGCGG - Intronic
1168267917 19:55232285-55232307 CAGGGTCAGCCCAAGGAGAGCGG + Intronic
1202709247 1_KI270714v1_random:8048-8070 GAGGATGAGCCAAAGCAGGGTGG + Intergenic
925641030 2:5985957-5985979 CAGGATGAGCTGAAGAAGAGGGG - Intergenic
925729249 2:6905451-6905473 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
926533456 2:14081961-14081983 GAGGGCGAGCCAAAGCAGAGTGG + Intergenic
926885102 2:17589933-17589955 CAGGAAGAGCGAAAGCAGGGAGG - Intronic
927027901 2:19089407-19089429 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
927117068 2:19916093-19916115 GAGGATGAGCCAAAGCAGGGTGG + Intronic
927221182 2:20711558-20711580 GAGGGTGAGCCAAAGCAGGGCGG + Intronic
929534744 2:42774029-42774051 CAGGATGACTCAAAGCAGGGAGG - Intronic
929819423 2:45261415-45261437 AAGGAGCACCCAAAACAGAGGGG + Intergenic
929876498 2:45801053-45801075 CAGCATAAGTGAAAGCAGAGAGG + Intronic
930476739 2:51891668-51891690 GAGGGTGAGCCAAAGCAGGGAGG - Intergenic
931004017 2:57827767-57827789 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
931204706 2:60136178-60136200 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
931480301 2:62633132-62633154 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
932437892 2:71713631-71713653 CAGGATTAGAGTAAGCAGAGAGG + Intergenic
935138309 2:100327702-100327724 CAGGCATAGCCGAAGCAGAGAGG + Intergenic
935950755 2:108326259-108326281 CTGGAACTGCCAAAGCAGTGTGG + Intergenic
935982724 2:108643343-108643365 GAGGATGAGCCGAAGCAGGGTGG + Intronic
936284975 2:111174821-111174843 CAGGAGCAACCAGAGAAGAGCGG + Intergenic
936649910 2:114413974-114413996 GAGGGTAAGCCAAAGCAGGGAGG - Intergenic
936769610 2:115895377-115895399 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
937355308 2:121194744-121194766 TAGGAGCAGCCACAGCAGTGAGG + Intergenic
937486867 2:122324456-122324478 CAGTATGAACCAAAGCAGAGGGG - Intergenic
938344681 2:130558615-130558637 CAGGATCAGGAAGAACAGAGGGG + Intergenic
938345152 2:130562105-130562127 CAGGATCAGGAAGAACAGAGGGG - Intergenic
938672187 2:133597158-133597180 CAGCATCCGGCAAAGCAGAGTGG + Intergenic
939179111 2:138783365-138783387 CAGAATGAGCAAAGGCAGAGTGG + Intergenic
939191291 2:138919476-138919498 CAGGATCAGCCAGACAAGACTGG + Intergenic
939795694 2:146641970-146641992 GAGGGTGAGCCAAAGCACAGTGG + Intergenic
940502895 2:154516602-154516624 AATGAGCAGTCAAAGCAGAGGGG - Intergenic
941734098 2:168953902-168953924 CAGGACAAGCCAAAGCAGAGAGG - Intronic
942732513 2:179075746-179075768 GAGGGTGAGCCAAAGCAGCGTGG + Intergenic
942779883 2:179629688-179629710 GAGGATGAGCCAAAGCAGGGTGG + Intronic
942958755 2:181804541-181804563 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
943112427 2:183622248-183622270 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
943482405 2:188436462-188436484 GAGGATCAGCTAAATCAGTGAGG - Intronic
943528549 2:189049774-189049796 AATGAACAGACAAAGCAGAGCGG - Intronic
943836729 2:192524316-192524338 GAGGGTGAGCCGAAGCAGAGTGG + Intergenic
944721054 2:202423548-202423570 CAAGATCAGCCTAGGCACAGTGG + Intronic
944883381 2:204038537-204038559 CAGGATTAGACACAGCTGAGGGG - Intergenic
944980784 2:205117553-205117575 CAGGGTCAGCCATAGAAAAGGGG - Intronic
945676682 2:212863495-212863517 AAGGAGACGCCAAAGCAGAGTGG - Intergenic
945788878 2:214278288-214278310 AAGGGTGAGCCAAAGCAGGGTGG - Intronic
947492041 2:230603490-230603512 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
948082871 2:235220665-235220687 CAGGGTCAGCTAAAGAAGAAAGG + Intergenic
948509780 2:238456057-238456079 CAGGAGATGCCAAATCAGAGTGG + Intergenic
948877407 2:240837012-240837034 TGGGAGCAGCAAAAGCAGAGGGG - Intergenic
1169296217 20:4402291-4402313 CAGGTTCATCCAAGGAAGAGTGG - Intergenic
1169397129 20:5242011-5242033 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1169638388 20:7720706-7720728 CATGAACAGCCAGATCAGAGGGG + Intergenic
1171050453 20:21853583-21853605 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1171514804 20:25720702-25720724 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1172575256 20:36002652-36002674 CAAAATCAGCCAAAGCAAAAAGG - Intronic
1173318728 20:41968476-41968498 GAGGATGAGCCAAAGCAGGGTGG - Intergenic
1173497441 20:43529758-43529780 GAGGAGCAGCAAAAGCATAGAGG + Intronic
1174106781 20:48167957-48167979 CAAGAGCCTCCAAAGCAGAGTGG + Intergenic
1175496332 20:59417050-59417072 CAGGAGCAGCCTGAGCACAGGGG - Intergenic
1175836736 20:62000863-62000885 CTGCATCTGCCACAGCAGAGAGG + Intronic
1176709384 21:10136409-10136431 CAGGAGCTGCAAAAGGAGAGAGG - Intergenic
1176861643 21:14014335-14014357 CAGGACCACACAAGGCAGAGCGG + Intergenic
1176976521 21:15327271-15327293 CAGGCTCAGCCAGAGCTGAGTGG + Intergenic
1177425809 21:20921925-20921947 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1178103514 21:29295514-29295536 CAGGCTCAGCCACATGAGAGGGG + Intronic
1179440637 21:41391068-41391090 CAGGATCTTCCAAAGAAGTGCGG - Intronic
1179481513 21:41681639-41681661 CAGGAACAGCCTGAGCAGGGTGG + Intergenic
1179775889 21:43661840-43661862 CAGGAGAAGCAAAGGCAGAGAGG - Intronic
1180641040 22:17299609-17299631 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1180898151 22:19352309-19352331 CAGGATGAAGCAAACCAGAGTGG + Intronic
1182461121 22:30484798-30484820 CAGCATGAGCAAAGGCAGAGGGG + Intergenic
1183547479 22:38462388-38462410 GAGGGTCTGCCAGAGCAGAGAGG - Intergenic
1184991427 22:48172738-48172760 CAGGAACAGCCTCAGGAGAGGGG + Intergenic
1185345640 22:50309429-50309451 GAGGCTCAGCCAACTCAGAGCGG + Exonic
1185379839 22:50503291-50503313 CAGGGTCAGCTAAGGCACAGTGG + Exonic
949155840 3:826702-826724 CAGTCTCAGCCACAGCAGAAGGG + Intergenic
950299920 3:11867969-11867991 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
951434310 3:22643735-22643757 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
951439560 3:22707351-22707373 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
951687679 3:25362767-25362789 AAGGATGAGCCAAAGCAGGGTGG - Intronic
952251967 3:31664300-31664322 CAGGAGCAGCCAGAGCAGCGAGG + Intronic
952514035 3:34085681-34085703 GAGCATGAGCCAAAGCAGGGCGG - Intergenic
953706405 3:45234423-45234445 CAGGTTCAGTCACACCAGAGGGG - Intergenic
954143374 3:48621718-48621740 CAGGAGCAGCAAAGGCAGCGAGG + Exonic
954978770 3:54723679-54723701 GAGGGTGAGCCGAAGCAGAGTGG - Intronic
955630341 3:60966403-60966425 GAGCATGAGCCAAAGCAGGGCGG - Intronic
956300306 3:67764770-67764792 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
958793508 3:98681663-98681685 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
959091891 3:101911680-101911702 AAGGATGAGCCAAAGCAGAGTGG - Intergenic
960226988 3:115179908-115179930 GAGGGTAAGCCAAAGCAGGGTGG - Intergenic
960478762 3:118162747-118162769 GAGGGCAAGCCAAAGCAGAGGGG + Intergenic
961041905 3:123683632-123683654 CTGGATTACCCATAGCAGAGAGG - Intronic
961376391 3:126468864-126468886 CAGGACCAGCAACAGCACAGTGG - Intronic
963858415 3:150280546-150280568 CAGGATCAGCCAGCAGAGAGAGG + Intergenic
964742250 3:159978566-159978588 CAGAGTCCACCAAAGCAGAGGGG + Intergenic
965880363 3:173381996-173382018 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG + Intronic
966921341 3:184613607-184613629 CAGGATGTGCAAATGCAGAGAGG + Intronic
967199340 3:187058267-187058289 GAGGACGAGCCAAAGCAGGGTGG - Intronic
968132160 3:196198174-196198196 CAGGGTCAGCCAAACCTCAGGGG + Intronic
968487736 4:872037-872059 CAGGAACACCCAGAGCAGAGTGG + Intronic
969582463 4:8073150-8073172 CAGGATCAAGCACGGCAGAGGGG + Intronic
970881558 4:20938255-20938277 CAGGAGAAGCCAAGGCAAAGAGG + Intronic
971162010 4:24142807-24142829 TAGGATGAGCCAAAGCACTGAGG + Intergenic
971883158 4:32409228-32409250 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
973048949 4:45571087-45571109 CATGGTCTGCCAAACCAGAGAGG + Intergenic
974106324 4:57473187-57473209 GAGGGCAAGCCAAAGCAGAGTGG - Intergenic
974373752 4:61049844-61049866 TAGGATCAGCCACAGCAGCAGGG - Intergenic
975727204 4:77303560-77303582 GAGGATGAGCCAAAGCAGGGTGG - Intronic
976102444 4:81580393-81580415 CAGCATCAGCCAGCCCAGAGAGG - Intronic
976167519 4:82271620-82271642 GAGGGTGAGCCAAAGCACAGTGG + Intergenic
976439196 4:85054646-85054668 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
976827055 4:89272414-89272436 CATGATCAGTCACACCAGAGTGG + Intronic
978902549 4:113970137-113970159 CAGAATGAGCCAAAGAAGAGAGG + Intronic
978925625 4:114239524-114239546 CAAGATCAGCCTAAGCAGCATGG - Intergenic
979241938 4:118454903-118454925 CAGGAACAGCCTCAGCATAGGGG - Intergenic
979272911 4:118783076-118783098 GAGGGTGAGCCAAAGCAGGGCGG - Intronic
979457511 4:120943915-120943937 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
979730192 4:124014379-124014401 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
980738299 4:136918338-136918360 TGGAATCAGCCAGAGCAGAGCGG + Intergenic
981068305 4:140508356-140508378 GAGGGTGAGCCAAAGCAGAACGG + Intergenic
981254740 4:142648340-142648362 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
981655885 4:147112100-147112122 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
982625503 4:157760806-157760828 CAGGGCAAGCCAAAGCAGGGTGG - Intergenic
983233251 4:165150713-165150735 GAGCATCAGCCAAAGCAGGAGGG - Intronic
983331468 4:166334038-166334060 GAGGATTAGCCAAAGCAGGGTGG - Intergenic
983592629 4:169431150-169431172 AAGGATGAGCCAATGCAGATTGG + Intronic
984171084 4:176360021-176360043 CAGGAGCAGCCAAGGCACAAAGG + Intergenic
984724928 4:183011715-183011737 CAGGCTCAGCCCCTGCAGAGGGG - Intergenic
986303352 5:6496022-6496044 CAGCAACAATCAAAGCAGAGGGG + Intergenic
986473791 5:8103494-8103516 CAAGATCTGCCAAAGTGGAGGGG - Intergenic
987411670 5:17620960-17620982 CAGGCTCAGCCCAAGGAGAGGGG - Intergenic
987415279 5:17655559-17655581 CAGGCTCAGCCCAAGGACAGGGG - Intergenic
987416784 5:17670604-17670626 CAGGCTCAGCCCAAGGACAGGGG - Intergenic
989056652 5:37372000-37372022 CAGGATAGGAGAAAGCAGAGAGG + Intergenic
989107734 5:37879360-37879382 CAAGATCCCCCAGAGCAGAGGGG - Intergenic
989200034 5:38754048-38754070 AAGGAGCTGACAAAGCAGAGGGG + Intergenic
989345331 5:40423184-40423206 GAGGATGAGCCGAAGCAGGGCGG - Intergenic
989614784 5:43328847-43328869 GAGGGTGAGCCAAAGCAGGGCGG - Intergenic
989619135 5:43367528-43367550 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
989670246 5:43908845-43908867 GAGGGTGAGCCAAAGCAGGGAGG + Intergenic
989671182 5:43918400-43918422 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
990183851 5:53191630-53191652 GAGGGTGAGCAAAAGCAGAGTGG - Intergenic
990617780 5:57524803-57524825 CAGGATTCCCCTAAGCAGAGAGG - Intergenic
991026754 5:62037953-62037975 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
991223496 5:64242934-64242956 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
992506161 5:77389365-77389387 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
992533438 5:77673624-77673646 CCGGAACAGCCATGGCAGAGAGG + Intergenic
992580975 5:78175192-78175214 GAGGGTGAGCTAAAGCAGAGTGG - Intronic
993065207 5:83089910-83089932 TAGGAACAGCCAAATGAGAGAGG + Intronic
993081792 5:83310281-83310303 CAAGATGAGCCAAAGTAGGGAGG + Intronic
993460253 5:88173406-88173428 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
993757712 5:91751497-91751519 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
993948055 5:94138420-94138442 GAGGGTAAGCCAAAGCAGGGCGG - Intergenic
994039634 5:95244350-95244372 GAGGATGAGCCAAAGCAGGGCGG + Intronic
994586568 5:101716247-101716269 GAGGGTGAGCCAAAGCAGGGCGG - Intergenic
994850901 5:105053683-105053705 GAGGGTCAGCAGAAGCAGAGTGG - Intergenic
995375598 5:111470987-111471009 CAGGCTAAGCAAAAGCAGATTGG - Intronic
995459724 5:112390217-112390239 GAGGGTGAGCCAAAGCAGGGCGG + Intronic
996403328 5:123085836-123085858 CAGGAGCACCCAGGGCAGAGCGG + Intergenic
996964656 5:129293658-129293680 TAGGATCAGCCAAGGAAAAGAGG + Intergenic
997115642 5:131123147-131123169 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
997533769 5:134599815-134599837 CAGCATCAGAAAAAGCTGAGAGG + Intergenic
998063622 5:139138790-139138812 TAGGATAAGCAAAAGCAGCGAGG + Intronic
998182336 5:139954251-139954273 CAGCAGCAGCCAAGCCAGAGAGG + Intronic
998752161 5:145334068-145334090 GAGGTTGAGCCAAAGCAGGGTGG - Intergenic
998801907 5:145877733-145877755 GAGGGTGAGCCAAAGCAGGGCGG + Intergenic
999488796 5:152027302-152027324 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
999688234 5:154121976-154121998 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
999921274 5:156323783-156323805 CAGGCACAGCCATTGCAGAGGGG + Intronic
1000214250 5:159139692-159139714 GAGGGTAAGCCAAAGCAGGGCGG + Intergenic
1000786440 5:165550046-165550068 CAGGGTGAGCTGAAGCAGAGTGG - Intergenic
1001076328 5:168630848-168630870 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1001086099 5:168701032-168701054 CACGATCAGCCAACCCAGATGGG - Intronic
1002734894 5:181377865-181377887 GAGGGTGAGCCAAAGCAGAATGG - Intergenic
1002749634 6:96257-96279 GAGGGTGAGCCAAAGCAGAATGG + Intergenic
1004120760 6:12819727-12819749 CAGAATCATTCAAAGCAGTGAGG + Intronic
1006738663 6:36292515-36292537 CAGCAGCAGGCAAAGCAGTGTGG - Intronic
1006779960 6:36625740-36625762 CAGCATGAGCAAAGGCAGAGAGG + Intergenic
1007254136 6:40516758-40516780 CAGGAGCAGCCAAGGATGAGTGG + Intronic
1007385038 6:41514799-41514821 CAGCAACAGGCCAAGCAGAGGGG - Intergenic
1007909963 6:45503648-45503670 CAGGATATGCCAAGGCTGAGAGG + Intronic
1007917577 6:45575408-45575430 CAGGATTAGCCAGGGCAGAGTGG - Intronic
1008037027 6:46756273-46756295 CATTTTCAGCCAAAGGAGAGAGG + Intronic
1008528065 6:52427505-52427527 GAGGAACTGCCATAGCAGAGTGG - Intronic
1009777188 6:68219268-68219290 GAGGGTTAGCCAAAGCAGGGTGG - Intergenic
1009936469 6:70240464-70240486 CAAGATCAAGTAAAGCAGAGAGG - Intronic
1011288568 6:85751802-85751824 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1011340382 6:86307184-86307206 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1011508704 6:88076608-88076630 GAAGAGAAGCCAAAGCAGAGTGG + Intergenic
1011782180 6:90801812-90801834 CAGCATCAGCAAAGGCACAGAGG + Intergenic
1011909662 6:92420904-92420926 GAGGGACAGCCAAAGCAGGGCGG + Intergenic
1012383170 6:98644716-98644738 CAGCATCTCCCAAATCAGAGAGG - Intergenic
1013768893 6:113605068-113605090 CAGGATAAACCAGAGGAGAGAGG - Intergenic
1014568960 6:122986019-122986041 GAGGGCAAGCCAAAGCAGAGTGG + Intergenic
1014749061 6:125234890-125234912 CAAGATCAGCCTGAGCAGCGTGG + Intronic
1015211231 6:130701458-130701480 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1015290986 6:131538399-131538421 GAGGGTGAGCCAAAGCAGAGTGG + Intergenic
1016584883 6:145673446-145673468 GAGGGTGAGCCAAAGCAGGGCGG + Intronic
1017197505 6:151717152-151717174 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1017418682 6:154249640-154249662 TGGGATCAGCCAAGGCAGAGAGG + Intronic
1017822548 6:158060026-158060048 CAGGACCAGCCAGGGCAGAAAGG - Intronic
1018184212 6:161251812-161251834 CAGGAGGAACAAAAGCAGAGAGG + Intronic
1019239154 6:170650182-170650204 GAGGGTGAGCCAAAGCAGAATGG - Intergenic
1020478102 7:8623013-8623035 CAGAAAGAGCAAAAGCAGAGTGG + Intronic
1020659547 7:10966065-10966087 GAGGACAAGCCAAAGCAGGGTGG - Intergenic
1020753497 7:12171152-12171174 GAGGGTTAGCCAAAGCAGGGTGG - Intergenic
1020795631 7:12675808-12675830 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1021099433 7:16571539-16571561 GAGGGACAGCCAAAGCAGAATGG + Intronic
1021307138 7:19045884-19045906 GAGGCAGAGCCAAAGCAGAGTGG + Intronic
1023464108 7:40434859-40434881 CAGCATCAGAAAAAGCATAGGGG - Intronic
1023568990 7:41553118-41553140 GAGGGTGAGCCAAAGCAGAGTGG - Intergenic
1027701749 7:81478611-81478633 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1028114447 7:86981830-86981852 GAGGGTGAGCCAAAACAGAGTGG + Intronic
1028142697 7:87290035-87290057 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1028318951 7:89436990-89437012 AAAGATCTGCAAAAGCAGAGGGG - Intergenic
1028326941 7:89539806-89539828 GAGGATAAGCCAAAGCAGAGTGG + Intergenic
1028340891 7:89718853-89718875 GAGGGTGAGCCAAAGCAGGGAGG + Intergenic
1028523557 7:91758886-91758908 AAGGGTGAGCCAAAGCAGGGTGG + Intronic
1029051812 7:97697538-97697560 CAGCTTCAGCAAAGGCAGAGGGG - Intergenic
1029062237 7:97810513-97810535 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1029324851 7:99797028-99797050 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1029366459 7:100119598-100119620 CAGGATCAGCCCAACAAGGGTGG - Exonic
1029549584 7:101230599-101230621 CAGGAGCTGCCAAGGCAGGGCGG + Intergenic
1029952007 7:104596032-104596054 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1030142568 7:106320319-106320341 GAGCATGAGCCAAAGCAGGGAGG + Intergenic
1030181026 7:106709549-106709571 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1033862754 7:145648352-145648374 CAGGAGAATCCAAAGCAGATGGG - Intergenic
1034284831 7:149877990-149878012 CAGAAACAGACAAAGCAGTGTGG + Intronic
1035383377 7:158454750-158454772 CAGGTTCAGTGACAGCAGAGTGG + Intronic
1035508618 8:156426-156448 GAGGGTGAGCCAAAGCAGAATGG + Intergenic
1036051167 8:5199700-5199722 CAGAATCAGCCCACGTAGAGGGG - Intergenic
1037228222 8:16621523-16621545 CAGGTTGAGCTAAAGAAGAGAGG - Intergenic
1038455911 8:27671904-27671926 CAGGCTCAGTCACAGGAGAGGGG - Exonic
1039624384 8:39032642-39032664 GAGGGTGAGCCAAAGCAGGGCGG - Intronic
1040410844 8:47152915-47152937 GAGGGTTAGCCAAAGCAGGGTGG + Intergenic
1040473936 8:47760418-47760440 GAGGGCAAGCCAAAGCAGAGTGG - Intergenic
1041620812 8:59966451-59966473 CTGAATTAGCCAAAGCAGAATGG - Intergenic
1042645326 8:70980233-70980255 GAGGGTGAGCCAAAGCAGGGCGG - Intergenic
1042812987 8:72846241-72846263 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1042877725 8:73455190-73455212 CAGAGCCAGCCCAAGCAGAGCGG - Intronic
1043071211 8:75638095-75638117 GAGTGTGAGCCAAAGCAGAGCGG - Intergenic
1043080838 8:75763177-75763199 GAGGGTGAGCAAAAGCAGAGTGG + Intergenic
1044131011 8:88525032-88525054 GAGGATGAGCCAAAGCAAGGTGG + Intergenic
1045557002 8:103224401-103224423 CAGGACAACTCAAAGCAGAGTGG + Intronic
1045920537 8:107523639-107523661 CAGGAGAAGCCATATCAGAGAGG + Intergenic
1046219864 8:111200498-111200520 GAGGGCCAGCCAAAGCAGGGTGG + Intergenic
1046222651 8:111236147-111236169 CTGGATCACCTAAGGCAGAGAGG - Intergenic
1048231277 8:132644509-132644531 GAGGATTAGCCAAAGCAAGGGGG + Intronic
1048325398 8:133435137-133435159 CAGCATCAGCCAAAGCGCATGGG - Intergenic
1049015774 8:139918965-139918987 CAGGTCCAGCAAAAGCAGGGAGG + Intronic
1049622323 8:143604258-143604280 CAGGGTCAGCCTAAGGAGATGGG - Exonic
1050193969 9:3060884-3060906 AATGAACAGACAAAGCAGAGGGG + Intergenic
1050197044 9:3096310-3096332 AAAGGTCAGCCAAAGGAGAGAGG - Intergenic
1050201420 9:3149279-3149301 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1050678726 9:8085452-8085474 GAGGGTGAGCCAAAGCAGCGTGG - Intergenic
1050681166 9:8113411-8113433 CAGGATGAGCAAAGGCAGAATGG + Intergenic
1051199355 9:14599292-14599314 GAGGATGAGCCAAAGCAGGGTGG + Intergenic
1052052800 9:23866893-23866915 GAGGGTAAGCCAAAGCAGGGTGG - Intergenic
1052125219 9:24765701-24765723 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1052382417 9:27785480-27785502 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1053284227 9:36840034-36840056 CAGGGTCACCCAGGGCAGAGAGG + Exonic
1053582926 9:39425791-39425813 GAGCATGAGCCAAAGCAGGGCGG + Intergenic
1053847109 9:42250656-42250678 GAGCATGAGCCAAAGCAGGGCGG + Intergenic
1054104505 9:60984534-60984556 GAGCATGAGCCAAAGCAGGGCGG + Intergenic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1055494492 9:76841161-76841183 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1055614208 9:78054368-78054390 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1055649575 9:78394148-78394170 CAGGAAGACTCAAAGCAGAGAGG - Intergenic
1056578814 9:87875635-87875657 CAGGGGCAGCCCAGGCAGAGAGG + Intergenic
1056750242 9:89345385-89345407 TTGAATGAGCCAAAGCAGAGCGG + Intronic
1058267255 9:102918159-102918181 CAGGAACAGATAAAGCAGTGAGG - Intergenic
1060525786 9:124320559-124320581 CAGGATCTGGGAAAGCAGAGGGG - Intronic
1061309122 9:129750928-129750950 CAGGAGCAGCCCAAGGAGTGGGG + Intronic
1061989281 9:134149477-134149499 CAGGAACAGCCAGAGGGGAGGGG + Intronic
1062203481 9:135321555-135321577 CAGAATGAGCCACGGCAGAGTGG - Intergenic
1062697732 9:137884093-137884115 CAGGAGCAGGCAGAGCAGATGGG - Intronic
1062759360 9:138330473-138330495 GAGGGTGAGCCAAAGCAGAATGG - Intergenic
1202794143 9_KI270719v1_random:105376-105398 CAGGAGCTGCAAAAGGAGAGAGG - Intergenic
1203599809 Un_KI270748v1:1245-1267 GAGGGTGAGCCAAAGCAGAATGG - Intergenic
1186555648 X:10555646-10555668 CAGGATCTGATAAAGCAGATAGG + Intronic
1186949030 X:14602247-14602269 AAGGATCAGCCAGAGCTGACTGG + Intronic
1186961034 X:14736533-14736555 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1187284354 X:17889635-17889657 GAGACTCAGCTAAAGCAGAGAGG + Intergenic
1187729486 X:22238280-22238302 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1187840496 X:23482177-23482199 GAGGGTGAGCCGAAGCAGAGTGG - Intergenic
1188084078 X:25882385-25882407 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1188201602 X:27299365-27299387 GAGGGCGAGCCAAAGCAGAGTGG + Intergenic
1188479022 X:30618387-30618409 CAGGAGACGCCAAATCAGAGTGG + Intergenic
1188893380 X:35636658-35636680 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1189017725 X:37301550-37301572 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1189114368 X:38327629-38327651 CAGGCTCAGGCACAGCGGAGGGG + Intronic
1189243266 X:39542004-39542026 TAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1189713508 X:43840635-43840657 GAGGATGAGCCTAAGCAGGGTGG + Intronic
1191012478 X:55774887-55774909 AAGGGCAAGCCAAAGCAGAGAGG - Intergenic
1191168619 X:57418525-57418547 GAGGATGAGCCAAAGCAGGGTGG - Intronic
1192674506 X:73182230-73182252 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1192964079 X:76159169-76159191 GAGGGTGAGCCAAAGCAGAGTGG + Intergenic
1192992048 X:76471073-76471095 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1193068517 X:77282672-77282694 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1193117324 X:77788024-77788046 CAGGAGCTGCCAGAGCACAGGGG + Intergenic
1193356077 X:80521465-80521487 GAGGGTGAGCCGAAGCAGAGTGG - Intergenic
1193409279 X:81143516-81143538 CAGGGTGAGCCAAAGCAGAATGG + Intronic
1193419959 X:81271220-81271242 GAGGGCAAGCCAAAGCAGAGTGG - Intronic
1193542409 X:82788415-82788437 GAGGGTGAGCCAAAGCAGAGAGG + Intergenic
1194021176 X:88694343-88694365 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1194098507 X:89673962-89673984 GAGGACGAGCCAAAGCAGGGTGG + Intergenic
1195330447 X:103794117-103794139 CAGATTCAGCCATAGCAGACAGG + Intergenic
1195519333 X:105812748-105812770 GAGGGTGAGCCAAAGCAGGGAGG - Intergenic
1195832803 X:109078024-109078046 CAGGGTGAACCAAAGCAGGGTGG - Intergenic
1195985490 X:110626155-110626177 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1196108660 X:111922857-111922879 CAGGATTAGCCTAAGCAGCAGGG + Intronic
1196230236 X:113212507-113212529 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1196545818 X:116962885-116962907 GAGGGTTAGCCGAAGCAGAGTGG - Intergenic
1196587126 X:117443292-117443314 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1197489747 X:127102390-127102412 AAGGATGAGCCAAAGCAGGGTGG + Intergenic
1198853789 X:140994935-140994957 CAGGATATGCAAAGGCAGAGAGG - Intergenic
1199469898 X:148182343-148182365 GAGGTTGAGCCAAAGCAGGGTGG - Intergenic
1200333139 X:155319403-155319425 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1200451529 Y:3335337-3335359 GAGGACGAGCCAAAGCAGGGTGG + Intergenic
1201371554 Y:13269842-13269864 GAGGCGGAGCCAAAGCAGAGTGG - Intronic
1201394840 Y:13537107-13537129 CAGGGAGAGCCAAAGCAGGGTGG - Intergenic
1201913569 Y:19158197-19158219 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1202057348 Y:20848667-20848689 AAGCATGGGCCAAAGCAGAGTGG - Intergenic
1202389647 Y:24356728-24356750 CAGGAACAGCCTCAGCATAGGGG - Intergenic
1202481137 Y:25313386-25313408 CAGGAACAGCCTCAGCATAGGGG + Intergenic