ID: 1144667421

View in Genome Browser
Species Human (GRCh38)
Location 17:17111551-17111573
Sequence GAGGGAGACCTGGCAACGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 266}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144667408_1144667421 27 Left 1144667408 17:17111501-17111523 CCTGCTGGCCTGTGTGTCCAGGG 0: 1
1: 1
2: 3
3: 30
4: 313
Right 1144667421 17:17111551-17111573 GAGGGAGACCTGGCAACGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 266
1144667413_1144667421 19 Left 1144667413 17:17111509-17111531 CCTGTGTGTCCAGGGGGGTCTCT 0: 1
1: 0
2: 1
3: 9
4: 208
Right 1144667421 17:17111551-17111573 GAGGGAGACCTGGCAACGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 266
1144667414_1144667421 10 Left 1144667414 17:17111518-17111540 CCAGGGGGGTCTCTGTTTTCTGC 0: 1
1: 0
2: 1
3: 25
4: 271
Right 1144667421 17:17111551-17111573 GAGGGAGACCTGGCAACGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144667421 Original CRISPR GAGGGAGACCTGGCAACGGG TGG Intronic
900600382 1:3500267-3500289 GTGGGAGGCCTGGCACCTGGGGG - Intronic
900699111 1:4033005-4033027 GAGGGAGATCTGGAGAGGGGAGG + Intergenic
901667567 1:10835365-10835387 GCGGGAGGCCGGGCAAGGGGAGG + Intergenic
902652321 1:17844798-17844820 GAGGGAGACCTGGCCCCTGAGGG - Intergenic
903519267 1:23935009-23935031 GAGGGAGACCTTGGAAAGAGAGG - Intergenic
904280028 1:29412721-29412743 GAGAGAGCCCTGGCACCCGGTGG + Intergenic
904500772 1:30911626-30911648 CAGGGAGACCTGGGACCCGGGGG - Intergenic
905798616 1:40829521-40829543 GAGGGAGACCTCGAAACCAGGGG - Intronic
906250599 1:44308072-44308094 CAGTGAGACCTGGCAAAGGCAGG + Intronic
906647142 1:47483414-47483436 TAGGGAGACATGGCAAAGGCTGG + Intergenic
907241997 1:53086014-53086036 GTGGGAGAGCTGCCACCGGGAGG + Intergenic
908534600 1:65066601-65066623 GAGGGAGAACGGGCACGGGGCGG - Intergenic
910412867 1:86964615-86964637 GAGGGAGACCTTGGAAAGAGAGG + Intronic
912316816 1:108675099-108675121 GAGGGAGACCTTGGAAAGAGAGG - Intergenic
913220279 1:116654542-116654564 GAGGGCGCCCTGGCAAGGGAGGG - Intronic
917089481 1:171338291-171338313 GAGGGAGACCAGGTAAGAGGTGG - Intronic
918127247 1:181595536-181595558 GTGGGAGACCCGGGAAGGGGAGG - Intronic
919916914 1:202144590-202144612 GGCGGGGACCTGGCACCGGGCGG - Exonic
920228592 1:204455545-204455567 GAAGGAGACATGGCAACAGATGG - Intronic
920442340 1:205989419-205989441 GAGGGGCACCTGGCAAGGTGAGG - Intronic
920848592 1:209613248-209613270 CAGGGAGACCTGGAAGCTGGTGG - Exonic
922831638 1:228557375-228557397 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922832115 1:228609357-228609379 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922832675 1:228611598-228611620 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922833236 1:228613839-228613861 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922833796 1:228616080-228616102 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922834353 1:228618321-228618343 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922834915 1:228620552-228620574 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922835465 1:228622755-228622777 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922836023 1:228624997-228625019 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922836580 1:228627237-228627259 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922837140 1:228629478-228629500 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922837700 1:228631720-228631742 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922838258 1:228633960-228633982 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922838817 1:228636185-228636207 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922839376 1:228638426-228638448 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922839937 1:228640657-228640679 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922840497 1:228642898-228642920 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
922841060 1:228645129-228645151 GCGGGAGCCGTGGCACCGGGCGG + Intergenic
923812377 1:237333468-237333490 GAGGTAGCCCGAGCAACGGGGGG + Intronic
924719219 1:246607037-246607059 GAGGGAGACCAGGCTCCGGGGGG + Intronic
924722411 1:246636160-246636182 GAGGGAGACCAGGCTCCAGGGGG + Intronic
1064418862 10:15173149-15173171 CAGGGAGACATGGCATCTGGAGG - Intergenic
1065189488 10:23196836-23196858 GAGGGAGGCCTGGGGACAGGGGG - Intergenic
1071433333 10:85623611-85623633 GAGGGTGAACTTGCAACAGGAGG - Intronic
1075407453 10:122204135-122204157 GAGGGAGACCTTGGAAAGAGAGG + Intronic
1076504753 10:130964263-130964285 GAGTGAGACTGGGCAAGGGGAGG + Intergenic
1076783636 10:132738401-132738423 GAGGGGGATGTGGCAAAGGGAGG - Intronic
1076823022 10:132951053-132951075 GAGGGAGTCCAGTCAACTGGGGG + Intergenic
1076848531 10:133081842-133081864 GAGGGAGCCCTGGCTCCAGGGGG - Intronic
1077082231 11:729223-729245 CAGGGTCACCTGGCATCGGGTGG + Intergenic
1078177435 11:8980664-8980686 CAGAGAGGCCTGGCAACAGGAGG + Exonic
1079193823 11:18306148-18306170 CAGGGAGAGGTGGCAACGAGAGG + Exonic
1080145919 11:28983926-28983948 GAGGGACACCTGGTCACAGGTGG - Intergenic
1080191669 11:29557618-29557640 GAGGGAGGCCTGGAAACATGGGG - Intergenic
1080883316 11:36342660-36342682 CAGCGAGACTTGGAAACGGGTGG + Intronic
1082871171 11:57944623-57944645 GAGGGAGACCGGGGAGGGGGAGG + Intergenic
1083592597 11:63904323-63904345 GAGGGAGAACTGGAAAAGAGGGG - Intronic
1083996907 11:66277354-66277376 GAGGGGAACCTGGGAGCGGGGGG - Exonic
1084095133 11:66906408-66906430 GAGGGAGACCTGCCATCAGGAGG - Intronic
1084215603 11:67645474-67645496 GAGGGAGACCTGGCCAAGGAGGG - Intronic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1084378163 11:68792549-68792571 GAGGGAGAACAGGCACCGTGGGG - Intronic
1085385783 11:76157389-76157411 GTGGGAGGCCTGGGAAGGGGAGG + Intergenic
1085588594 11:77735125-77735147 GAGGGAGGGCTGGCTATGGGCGG + Intronic
1088256956 11:107911823-107911845 GAGGGAGACCTTGCAAAGAGAGG - Intronic
1088752687 11:112857986-112858008 GAGGGAGCCCTCGCAAGGTGAGG + Intergenic
1090686514 11:129128589-129128611 GAGGGAGACCGGGGAGAGGGAGG - Intronic
1091586039 12:1817502-1817524 GAGGGAGACCGGGGAAAGAGAGG - Intronic
1093214392 12:16346824-16346846 GAAGTAGACCTTGCAACAGGTGG + Intergenic
1095600741 12:44010318-44010340 CAGGGAGACATGGCAACAGAGGG - Intronic
1100723159 12:97380204-97380226 CAGGAAGACCTGGCTACAGGTGG - Intergenic
1103330241 12:120149229-120149251 GAGGGAGAGCTGGCCAGGCGTGG + Intronic
1103461257 12:121106894-121106916 GAGGGAGAGCTAGCAACTTGGGG + Intergenic
1103729811 12:123019987-123020009 GAGGGAGCCCTGGAAGCGTGTGG + Intronic
1104127447 12:125861555-125861577 GAGGGAGACCTGGCCCCTGGTGG - Intergenic
1104860728 12:131921997-131922019 GCGGGAGAACTGGCTCCGGGGGG + Exonic
1113900386 13:113793671-113793693 GAGGAAGAGCTGTCAACTGGGGG - Intronic
1114069340 14:19095440-19095462 GAGGGGGCCCTTGCAAAGGGAGG + Intergenic
1114092921 14:19304562-19304584 GAGGGGGCCCTTGCAAAGGGAGG - Intergenic
1114529443 14:23386615-23386637 CAGGGAGGCCTGGGAAGGGGTGG + Exonic
1115151057 14:30286126-30286148 GAGGGAGGCCTGGCAATACGTGG - Intergenic
1116510797 14:45744067-45744089 GAGGGAGACAGGGCAACTGAGGG - Intergenic
1118309796 14:64683700-64683722 GAGGGAGACCTGGGACCCAGGGG - Intergenic
1119109953 14:71962296-71962318 GAGGGAGGCCGGGCAGAGGGAGG + Intronic
1119517820 14:75262216-75262238 CAGGGAAACCTGGCAAGTGGAGG - Intronic
1119595158 14:75926027-75926049 GAGGGAGACCGGGGAAAGAGAGG + Intronic
1119705493 14:76780251-76780273 GAGGGACAGCTGGGAACTGGGGG + Exonic
1121729042 14:96173707-96173729 GAGGGAGACCTGGGGACATGAGG + Intergenic
1122154588 14:99742535-99742557 CAGGGAGATCTGGCAACTGCTGG + Intronic
1122631368 14:103109161-103109183 GAGGGAGACCGGGGGACAGGTGG - Intronic
1122770801 14:104096830-104096852 GAGAGAGCCCTGGCAGGGGGTGG - Intronic
1123031317 14:105452924-105452946 GAGGATGACCTGGAAACGGGAGG + Intronic
1125325551 15:38532894-38532916 GAGAGAAAACTGGCAAAGGGTGG + Intronic
1125793795 15:42389596-42389618 GAAGGAGGCCTGGCCATGGGCGG - Intronic
1127902767 15:63353441-63353463 GACCCAGACCTGGCAAAGGGAGG - Intronic
1128062075 15:64741525-64741547 GTGGGAGCCCTGGCAGCTGGGGG + Intronic
1128914054 15:71543702-71543724 GAGGGAGACCTGGCTACAGATGG + Intronic
1129607968 15:77034069-77034091 GAGGGAGGCCTGGCTGCTGGAGG + Intronic
1129892047 15:79077954-79077976 GAGTGGGACCTGGTAAGGGGTGG - Intronic
1131457864 15:92597323-92597345 GAAGGAGGCCTGGGAAAGGGAGG + Intergenic
1131593790 15:93775927-93775949 GAGGGAGACCTGCAAGAGGGAGG + Intergenic
1132725563 16:1336876-1336898 GAGGGAGCACTGGCAAGGGAAGG + Intronic
1132849729 16:2019658-2019680 GAGGGAACCCTGGCAGCTGGCGG - Exonic
1132875835 16:2136471-2136493 GAGAGAGAACAGGCAATGGGAGG + Intergenic
1134341615 16:13351941-13351963 GAGGGAGAAATGACAACAGGTGG + Intergenic
1134519147 16:14910862-14910884 GAGAGAGAACAGGCAATGGGAGG - Intronic
1134554780 16:15155364-15155386 GAGAGAGAACAGGCAATGGGAGG + Intergenic
1134706817 16:16309517-16309539 GAGAGAGAACAGGCAATGGGAGG - Intergenic
1134726167 16:16420062-16420084 GAAAGAGACCTGTCAACAGGGGG + Intergenic
1134941267 16:18291798-18291820 GAAAGAGACCTGTCAACAGGGGG - Intergenic
1134960723 16:18402607-18402629 GAGAGAGAACAGGCAATGGGAGG + Intergenic
1135858106 16:26030702-26030724 GAGTGAGACCTGGCATCTGCTGG + Intronic
1136016756 16:27405667-27405689 GAGGGAGAGGGGGCAATGGGAGG + Intronic
1136223325 16:28842914-28842936 GAGGGAGCCCTGGCTAGGGCAGG + Exonic
1136655393 16:31706325-31706347 GAGGGAGACTTGGGCACTGGGGG - Intergenic
1137390694 16:48079049-48079071 CAGATAGACCAGGCAACGGGAGG + Intergenic
1138530742 16:57633005-57633027 GACAGAGACCTGGGGACGGGAGG - Intronic
1139951815 16:70676120-70676142 GAGGGGTGCCTGGCAAAGGGGGG + Intronic
1140504619 16:75463879-75463901 GTGGGAGACCCAGCAACAGGTGG + Intronic
1140512167 16:75516662-75516684 GTGGGAGACCCAGCAACAGGTGG + Intergenic
1140985651 16:80155999-80156021 GAGTGAGACCTGGAGAGGGGAGG + Intergenic
1141716778 16:85731440-85731462 GAGGGTCACCTGGAAACAGGTGG + Intronic
1142782880 17:2195025-2195047 GAGGAAGACCTAGCAAGAGGCGG + Intronic
1142817851 17:2441299-2441321 GTGGGAGACCGGGTGACGGGAGG + Intronic
1144667421 17:17111551-17111573 GAGGGAGACCTGGCAACGGGTGG + Intronic
1146193202 17:30788428-30788450 GAGGGAGACCTGGAAGGAGGGGG + Intronic
1146649562 17:34598328-34598350 GAGGGAGACATGGCACAGTGGGG + Intronic
1147442942 17:40458474-40458496 GAGGGAGCCCGCGCAGCGGGCGG - Intergenic
1147586529 17:41656466-41656488 GATGGAGACCTGGGAGCAGGAGG - Intergenic
1148192767 17:45691355-45691377 GAGGGATATCTGGCAACGGCTGG - Intergenic
1148648151 17:49230869-49230891 GAGGGAGGCGTGGCCTCGGGCGG - Intergenic
1150283831 17:63944624-63944646 GAGGGAGGCCCAGCACCGGGAGG + Intronic
1152245778 17:79183912-79183934 GAGCAAGTGCTGGCAACGGGGGG - Intronic
1152408323 17:80109915-80109937 GAGGGAAACCTGTCAAGGTGAGG - Intergenic
1152595542 17:81236062-81236084 GAGGGAGGCCTGGCTCCAGGTGG - Intronic
1152843055 17:82582305-82582327 GGTGGAGAGCTGGCAACAGGAGG - Intronic
1156197422 18:34790950-34790972 GAGGGAGAATAGGCAGCGGGAGG + Intronic
1158196134 18:54886995-54887017 GAGGGAGAGTTGGCGAGGGGAGG - Intronic
1158561728 18:58520067-58520089 GTGTGAGTCCTGGCAACGGATGG - Intronic
1159621405 18:70643168-70643190 GAGGGAGACCTGGCACAGGGTGG + Intronic
1160910015 19:1469954-1469976 GAGGGAGAGCTGGCCGCCGGCGG - Exonic
1161228108 19:3157287-3157309 GAGGGAGACCTGGCCGGGCGCGG - Intronic
1161421518 19:4178431-4178453 GGGTGAGACCTGGCAAAGAGGGG + Intronic
1162335797 19:10059539-10059561 GTGGGAGAGATGGCAAGGGGAGG + Intergenic
1162459223 19:10804206-10804228 GAGGGAGCCCTGGCAAGGATGGG + Intronic
1163632249 19:18423475-18423497 GAGTGAGACCTGGTGACGGATGG + Intronic
1164256792 19:23534309-23534331 GAGGGAGACCTTGGAAAGAGAGG + Intronic
1166298938 19:41903496-41903518 GAGGGAGACAAGCCAAGGGGTGG - Intronic
1167308194 19:48720799-48720821 CAAGGAGACGTGGCCACGGGAGG + Exonic
1167354716 19:48996179-48996201 GAAGGAGACCTGGGGATGGGTGG + Intronic
1167618974 19:50551015-50551037 GAGGTAGACATGGCAGCGGCAGG - Exonic
1167697497 19:51024010-51024032 GAGGGGAACCTGGCAGGGGGTGG - Intronic
1167971747 19:53192278-53192300 GGGGGAGACCTGGGATCTGGGGG - Intronic
1168293859 19:55369603-55369625 GCGGGAGAGCTGGCGGCGGGGGG + Intronic
925120056 2:1411390-1411412 GATGGAGACCTGGGAAGAGGGGG - Intronic
925956226 2:8968148-8968170 GAGGGATACCTGGCCATGTGAGG - Intronic
926172029 2:10558563-10558585 CAGGAAAACCAGGCAACGGGAGG + Intergenic
926278527 2:11425148-11425170 GAGGGAGACCAGGCTCCGTGGGG - Intergenic
927489898 2:23514307-23514329 GAGAGAGACCTGGGCAGGGGAGG + Intronic
928585680 2:32755560-32755582 GAGGGAGACCTTGGAAAGAGAGG + Intronic
929674921 2:43916928-43916950 GAGTGAGACCTGTCTCCGGGGGG + Intronic
931244677 2:60482087-60482109 GAGGCAGACCTGTTAAGGGGCGG + Intronic
931739379 2:65228112-65228134 AAGGGAGACCAGGGAACGGCCGG - Intronic
934522801 2:95030543-95030565 GTGGGAGACCTCGCATCTGGGGG - Intronic
934737621 2:96697952-96697974 GAGTGAGACCTGGGAGCTGGTGG + Intergenic
941695879 2:168550600-168550622 AAGGGAAACCTGGCAGCTGGTGG - Intronic
946149271 2:217753262-217753284 GAGGGAAGCCTGGGAACAGGTGG - Intronic
947514430 2:230789769-230789791 GAGGCAGACCTGGCAACCCAGGG - Intronic
948274724 2:236699648-236699670 GAAGGAGACACGGCAGCGGGAGG - Intergenic
948455967 2:238104808-238104830 GAGGGAGTAGTGGCCACGGGCGG - Exonic
948607661 2:239146463-239146485 GTGGGACACGTGGCATCGGGAGG + Intronic
948612045 2:239176172-239176194 GAGGGAGGCCGGGCAGAGGGAGG - Intronic
948612074 2:239176256-239176278 GAGGGAGGCCGGGCAGAGGGAGG - Intronic
948612082 2:239176275-239176297 GAGGGAGGCCGGGCAGAGGGAGG - Intronic
948612111 2:239176359-239176381 GAGGGAGGCCGGGCAGAGGGAGG - Intronic
948948886 2:241236280-241236302 GGGGGAGACGTTGCAACTGGAGG + Intronic
1169945011 20:10978960-10978982 GAGGGAGACGGGGCAGGGGGAGG - Intergenic
1171230267 20:23478884-23478906 GAGGGAGCCCTGACACCAGGTGG - Intergenic
1173522879 20:43712273-43712295 AAGGGAGAGCTGGGAACGGTGGG + Intronic
1174432027 20:50477293-50477315 GAGGGAGACCTGGGGATTGGAGG - Intergenic
1174451883 20:50625687-50625709 GAGGGAGACCTGGCTGAGGAGGG + Intronic
1176109363 20:63404475-63404497 AAGGGAGACCTGGCAGTGGAGGG - Intergenic
1178316284 21:31569327-31569349 GAGAGACACCTGGCCACGTGAGG - Intergenic
1178690863 21:34748425-34748447 GAGGGACACCTGGCCACAGAAGG - Intergenic
1179242127 21:39601887-39601909 GAGGGAGACCAGGCATGGGGTGG + Intronic
1180101601 21:45590352-45590374 GAGGGAAACCTGGGAGCGGGCGG - Intergenic
1180140906 21:45892945-45892967 GAGGGAGTCCTGGGGAGGGGAGG + Intronic
1180487811 22:15818003-15818025 GAGGGGGCCCTTGCAAAGGGAGG + Intergenic
1180821580 22:18832561-18832583 GAGGGCGCCCTGGCAAGGGAGGG - Intergenic
1180908488 22:19431953-19431975 GAGGCAGAGCTGGTGACGGGCGG - Exonic
1180910452 22:19446715-19446737 GAGGGAGACCTGTCTCAGGGGGG - Intronic
1181191398 22:21143484-21143506 GAGGGCGCCCTGGCAAGGGAGGG + Intergenic
1181207801 22:21267026-21267048 GAGGGCGCCCTGGCAAGGGAGGG - Intergenic
1182070401 22:27459424-27459446 CAGGGAGACCTGGCCAAGGCAGG - Intergenic
1183940780 22:41294070-41294092 GAGGGAGACCTTGGAAAGAGAGG - Intergenic
1183987171 22:41576116-41576138 GAGGGAGGGCTGGCCAGGGGTGG + Exonic
1203219120 22_KI270731v1_random:28390-28412 GAGGGCGCCCTGGCAAGGGAGGG + Intergenic
1203271705 22_KI270734v1_random:58437-58459 GAGGGCGCCCTGGCAAGGGAGGG - Intergenic
949537180 3:5005055-5005077 GAGGGAGATGAGGCAACCGGTGG - Intergenic
950121020 3:10482649-10482671 GGGGGAGACCTGGCACTGGTGGG - Intronic
952497394 3:33928049-33928071 CAGGGAGGCCTGGCAAAAGGTGG + Intergenic
952533459 3:34286245-34286267 GAGGAAGACCTGACAAGGAGTGG + Intergenic
953797335 3:45995589-45995611 GAGGGAGACCTGGGATGGGCGGG + Intronic
954699927 3:52445791-52445813 GAGGGAGGCAGGGCAAGGGGAGG - Intergenic
954802144 3:53193608-53193630 GGGGGAGACATGGAAACGGTGGG - Intergenic
955755534 3:62221702-62221724 GAGGCAGGCCTGGCACCGGGGGG + Intronic
956903050 3:73736649-73736671 GAGGCACACCTGGGAAAGGGAGG + Intergenic
961653511 3:128429106-128429128 GAGGCCGACCTGGCCAGGGGTGG + Intergenic
964187189 3:153960546-153960568 GAGTGGGACCTGGAAAGGGGAGG - Intergenic
965774060 3:172209891-172209913 GAGGGAGTCCAGGCAGCAGGGGG + Intronic
968235587 3:197028816-197028838 GAGGGTGACCTGGTTTCGGGCGG - Intronic
978820422 4:112958571-112958593 GAGGGAGACCTTGGAAAGAGAGG + Intronic
978947370 4:114515920-114515942 GAGGGAGACCTTGGAAAGAGAGG - Intergenic
980908784 4:138975278-138975300 GAGGAAGACCTGGAAAGGGAAGG - Intergenic
981993529 4:150953383-150953405 GAGGGAGACCGTGCAAAGAGGGG - Intronic
982265648 4:153536173-153536195 GGGGCAGACCTGGCCACTGGGGG + Intronic
985992887 5:3578001-3578023 GAAGGAGACATGGCCAAGGGAGG - Intergenic
986220339 5:5763349-5763371 GAGGGACTCCTGGCAAGAGGTGG - Intergenic
986804820 5:11299865-11299887 AAGGGAGATCTGGCAAAGGCAGG + Intronic
988214289 5:28251127-28251149 GAGGGAAACCAAACAACGGGTGG - Intergenic
989048286 5:37295068-37295090 GAGGGAGACCTTGGAAAGAGGGG - Intronic
990625497 5:57605738-57605760 GAGGGAGACCTGGTCAGGGCAGG + Intergenic
990825542 5:59893789-59893811 GAGGGGGCCCTGCCAGCGGGAGG + Exonic
990958619 5:61368786-61368808 GATGGAGATCTGGTAAGGGGAGG + Intronic
991598052 5:68324530-68324552 GAGGGAGACCTTGGAAAGAGAGG + Intergenic
992533021 5:77670699-77670721 TAGGGAGGTCTGGCAATGGGTGG - Intergenic
992793799 5:80237628-80237650 TAGAGAGAACTGGCAACTGGTGG - Intronic
995994327 5:118282039-118282061 GAGGGAGACCGTGCAAAGAGAGG - Intergenic
998599520 5:143570910-143570932 GAAGGAGAACTGGCAATGGATGG + Intergenic
1001597435 5:172907147-172907169 GAGGGAGACCAGGCAGGGGATGG - Intronic
1004325014 6:14666514-14666536 GAGGGACACCTGGTCACAGGTGG + Intergenic
1005158581 6:22835753-22835775 GAGGGAGACCTTGGAAAGAGGGG - Intergenic
1005995053 6:30925824-30925846 GATGGAGGCCTGGCAGCAGGCGG + Intronic
1006404735 6:33838406-33838428 CAGGGAGACCCGGGAAAGGGAGG - Intergenic
1007749073 6:44061014-44061036 TAGGGAGACCTGGCAGGGTGGGG + Intergenic
1010085142 6:71908435-71908457 GAGGGAGACCTGGAGAGGAGTGG + Intronic
1010086554 6:71925253-71925275 GAGGGAGGGCAGGCAACGGATGG - Intronic
1018390274 6:163336362-163336384 GAGGGAGGCCTGGCCAAGGAAGG + Intergenic
1019911927 7:4106009-4106031 AAGGGAGACCAGGCACTGGGCGG + Intronic
1023612134 7:41981814-41981836 AAGGGAGAACTGGCAACCAGCGG + Intronic
1023688883 7:42765340-42765362 CAGGGAGTCCTGGAAATGGGAGG + Intergenic
1023896099 7:44434241-44434263 GGGGCAGACCTGGCAGCTGGGGG - Intronic
1024046913 7:45591263-45591285 GAGGGAGACCTGGCAGCTCCTGG - Intronic
1026436772 7:70406164-70406186 GAGGGAGGCCTGGCAAGGGAGGG - Intronic
1029409675 7:100400826-100400848 GAGGGAGAGCAGCCAACAGGGGG + Intronic
1032811300 7:135420845-135420867 GAGGGAGAACTGGCTACAGAAGG + Intronic
1033432187 7:141299525-141299547 GAGGCAGGCCTGGCCAAGGGAGG - Intronic
1034233806 7:149553543-149553565 GAGGGAGACCGTGGAAAGGGAGG - Intergenic
1034233812 7:149553562-149553584 GAGGGAGACCGTGGAAAGGGAGG - Intergenic
1034511404 7:151537885-151537907 GACGGAGACCAGGCAAGGGAGGG - Intergenic
1035392929 7:158517426-158517448 GAGGGAGACTTGGGAACTGCAGG - Intronic
1036220934 8:6921216-6921238 GAGGGAGTTCTGGCAGCAGGTGG - Intergenic
1037524123 8:19708111-19708133 GAGGGGGAACTGAGAACGGGAGG + Intronic
1038167804 8:25102452-25102474 GAGGGAGACCGTGCAAAGAGGGG - Intergenic
1042229492 8:66541981-66542003 GAGAAAGACTTGGCAACTGGAGG - Intergenic
1044983201 8:97736245-97736267 GAGGGAGACTGGGCGACGGAGGG + Intergenic
1047400969 8:124547092-124547114 GAGGGAAAGCTGGGAACGAGAGG + Exonic
1047983188 8:130204564-130204586 GCAGGAGACCTGGAAATGGGAGG - Intronic
1049441429 8:142611558-142611580 GAGGATGGCCTGGCAGCGGGCGG + Exonic
1051894633 9:21974839-21974861 GGGGGAGAGCAGGCAGCGGGCGG - Exonic
1053114635 9:35490219-35490241 AAGGGAGACCTTGGAACGCGGGG - Intronic
1053131059 9:35616024-35616046 GAAGGAGACCTTGCAAAGTGAGG - Exonic
1053379189 9:37635558-37635580 GAGGGGAACCTGGGAGCGGGGGG + Intronic
1055571132 9:77617922-77617944 GCTGGAGACCTGGGAACTGGTGG - Intronic
1056311306 9:85343631-85343653 AAGGGACACCTGGCATCTGGTGG - Intergenic
1057250134 9:93494392-93494414 GATGGAGACTTGGCAATGGAGGG - Intronic
1058348781 9:103996871-103996893 GAGGGAGACAGGACAACAGGTGG + Intergenic
1058720407 9:107759041-107759063 GAGGGAGTCCAGGAAACAGGAGG - Intergenic
1060243514 9:121925378-121925400 GATGGAGGCCCGGCAGCGGGAGG - Intronic
1060986939 9:127825409-127825431 GAGCGAGGCCTGGCGTCGGGTGG + Intronic
1061400842 9:130367536-130367558 GAGGGTGACCAGGCAACTGGTGG - Intronic
1062141084 9:134959513-134959535 GAGGAAGACCTGGCTCCAGGTGG + Intergenic
1062626564 9:137445660-137445682 GTGGGAGATTTGGCAGCGGGAGG + Intergenic
1186535585 X:10343838-10343860 GTGGGAGACCTGGCAGCCTGGGG + Intergenic
1186977943 X:14928354-14928376 GAGGGAGAATTGGCAAGGGGTGG - Intergenic
1187848442 X:23566030-23566052 GAGGGGTACCTGGCCATGGGAGG + Intergenic
1190319663 X:49172534-49172556 GAGGAAGAACTGGCGAAGGGCGG - Intronic
1195257698 X:103105257-103105279 GAGGGAGACCATGGAAAGGGAGG + Intergenic
1195698528 X:107684585-107684607 GATGGTGACCTGGCAGTGGGTGG + Intergenic
1197452780 X:126640772-126640794 GAGGGAGACCTGGAAAGAGAGGG - Intergenic
1199785352 X:151100347-151100369 GTGGGAGACCTGGGATAGGGTGG - Intergenic