ID: 1144668591

View in Genome Browser
Species Human (GRCh38)
Location 17:17118613-17118635
Sequence GGCGGTGACGACTGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144668579_1144668591 14 Left 1144668579 17:17118576-17118598 CCTTTGAACCATGAGGACTGTGG 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1144668591 17:17118613-17118635 GGCGGTGACGACTGGGAAGGGGG 0: 1
1: 0
2: 1
3: 15
4: 201
1144668578_1144668591 15 Left 1144668578 17:17118575-17118597 CCCTTTGAACCATGAGGACTGTG 0: 1
1: 0
2: 2
3: 18
4: 135
Right 1144668591 17:17118613-17118635 GGCGGTGACGACTGGGAAGGGGG 0: 1
1: 0
2: 1
3: 15
4: 201
1144668581_1144668591 6 Left 1144668581 17:17118584-17118606 CCATGAGGACTGTGGAGTACACC 0: 1
1: 0
2: 1
3: 11
4: 123
Right 1144668591 17:17118613-17118635 GGCGGTGACGACTGGGAAGGGGG 0: 1
1: 0
2: 1
3: 15
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144668591 Original CRISPR GGCGGTGACGACTGGGAAGG GGG Intronic