ID: 1144669390

View in Genome Browser
Species Human (GRCh38)
Location 17:17124451-17124473
Sequence ATGGATACACAGCTCATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144669390 Original CRISPR ATGGATACACAGCTCATCCA GGG Intronic
900970591 1:5990601-5990623 AAGGATAAACAGCCAATCCAAGG + Intronic
901794598 1:11673086-11673108 ATGGACAGACAGCTTATCCCCGG + Intronic
901954869 1:12776864-12776886 ATGGAGACTCTGCTCATTCAGGG - Intronic
902259166 1:15211277-15211299 ATAGATACACAGGGCATCCTTGG - Intronic
904872206 1:33625760-33625782 AGAGAAACACAGCTCATCCTGGG + Intronic
905626789 1:39494755-39494777 AGGGCCACACAGCACATCCAAGG + Intronic
907745378 1:57207813-57207835 ATGAATACATAGCCCATCCCAGG - Intronic
913160945 1:116146158-116146180 ATGGACACAAAGGTCCTCCAAGG + Intergenic
913669024 1:121077386-121077408 ATGGAAACACAGCTGATTTAGGG - Intergenic
914020769 1:143864821-143864843 ATGGAAACACAGCTGATTTAGGG - Intergenic
914659265 1:149772747-149772769 ATGGAAACACAGCTGATTTAGGG - Intergenic
915076129 1:153309230-153309252 GTGGTTACAAAGCACATCCAAGG + Intronic
917604179 1:176609480-176609502 ATGGATACACTTCGCTTCCATGG - Intronic
917835227 1:178936635-178936657 GTGTATAGACAGCTCATCCCTGG + Intergenic
917954984 1:180085995-180086017 AAGGATACAGAGCTCATAAATGG + Intronic
919092014 1:192987547-192987569 ATGGACACACAGGTTCTCCAAGG - Intergenic
919204265 1:194400369-194400391 ATGGAGAGACAGCTCAAACAAGG + Intergenic
919638743 1:200029429-200029451 CTGGAAACACAGTTCTTCCAGGG - Intronic
1064127821 10:12679629-12679651 ATGGATACACTGCACTTGCAGGG - Intronic
1064667683 10:17673593-17673615 AGGGTTACACAGCTCATCCTTGG - Intronic
1064987998 10:21230333-21230355 ATGCATGCTCAGCTCATCCTAGG - Intergenic
1068211067 10:53921539-53921561 AAGGATACACAGCTCAAGCCAGG + Intronic
1068875606 10:61992644-61992666 ATGGAAACACAGATCTTCCCAGG - Intronic
1071311225 10:84346512-84346534 AGGGATACCCAGCTAAACCATGG + Intronic
1071388109 10:85142037-85142059 ATGGACACACAGGTTCTCCAAGG - Intergenic
1072446534 10:95503688-95503710 AAGGCCACACAGCTAATCCATGG - Intronic
1072522843 10:96244212-96244234 ATAGAGACAGAGATCATCCAAGG + Intronic
1076524824 10:131105788-131105810 ATGGATACTCAGCCCATGCTTGG + Intronic
1078648900 11:13168775-13168797 ATGAAAACTCAGCTCCTCCAAGG - Intergenic
1083181040 11:60985634-60985656 ATGGAGAGACAGCTCATGCTTGG - Intronic
1086959031 11:92963790-92963812 GAGGTTATACAGCTCATCCAGGG + Intergenic
1089613522 11:119682545-119682567 AAGGTTGCACAGCTCATCAATGG - Intronic
1093577319 12:20747893-20747915 ATCAATACACAGCTCATCTTAGG + Intronic
1094058255 12:26287632-26287654 TTGGAACCACAGCTCCTCCATGG + Intronic
1094825498 12:34266326-34266348 AAGGAGACACATCTTATCCATGG + Intergenic
1096772694 12:53946110-53946132 AAGGATAAACATCTCTTCCAAGG + Exonic
1097457765 12:59820987-59821009 ATCCTTACACAGCTCACCCAAGG + Intergenic
1098383301 12:69892250-69892272 AAGGTTACACAATTCATCCAAGG + Intronic
1100764957 12:97853957-97853979 ATGGAAAAACAGCTAATTCAGGG - Intergenic
1102986988 12:117286168-117286190 AAGGACACAGAGCTCATCTATGG - Exonic
1103912505 12:124360171-124360193 ATGGATACACAGCTCCTTCCCGG + Intronic
1107734874 13:43388574-43388596 ATGGATACACTCCACATCCCAGG - Intronic
1108784342 13:53876835-53876857 ATAGATAAACAGCTCTTCCCAGG - Intergenic
1109351030 13:61181408-61181430 ATGGATAAACAGTTTATCCAAGG - Intergenic
1111783949 13:92764095-92764117 ATGGCTACTCAGCTCAGCCAAGG + Intronic
1112194040 13:97207473-97207495 AAGGATAGAAAGCTCATGCAGGG + Intergenic
1114212589 14:20627817-20627839 ATTCATACACAGTTCATACAAGG - Intergenic
1114487408 14:23071162-23071184 AGGGATAAACAGCACTTCCAGGG - Intronic
1116301627 14:43190503-43190525 ATATATACACACCTAATCCAAGG + Intergenic
1117964416 14:61191934-61191956 ATGTACACTCAGCTCATCCCAGG + Intronic
1118849040 14:69570978-69571000 AGAGAAACACAGCTCCTCCAAGG - Exonic
1120464911 14:84843983-84844005 ATGAATACACAGCTGTTCCCTGG - Intergenic
1121267566 14:92614213-92614235 ATGGCTGCACAGCTCACCCAAGG - Intronic
1122294530 14:100697876-100697898 CGGGTTACACAGCTCATCCAAGG + Intergenic
1126451421 15:48812860-48812882 AAGGCTACACAGCTAATACAAGG + Intergenic
1127503339 15:59575219-59575241 AAGGAGGCACAGCTCATTCATGG - Intergenic
1127634694 15:60858179-60858201 AGGGAAACACAGCTCATACATGG - Intronic
1127857789 15:62967020-62967042 ATGGCTACATAGCTGATTCAAGG + Intergenic
1129465543 15:75722406-75722428 ATGGAGACCCAGCTCACCCCTGG - Intergenic
1130315913 15:82796388-82796410 ATGGAAACACAGGTGAACCAAGG + Intronic
1132526361 16:417534-417556 ATGGATACACAGTTGACACAAGG + Intergenic
1137254476 16:46763670-46763692 ATGGATGCTCATTTCATCCACGG - Intronic
1137669995 16:50273267-50273289 AAGGTCACACAGCTCCTCCAAGG + Intronic
1139219286 16:65163171-65163193 ATGGTCACACAGCTCATTGAAGG + Intergenic
1142765577 17:2062325-2062347 AAGGATACACAGGTCTTCCCTGG - Intronic
1142807799 17:2380576-2380598 CCGCATACACAGCTCCTCCAAGG - Exonic
1142960298 17:3548313-3548335 ATGGAGAAGCAGCTCATCCATGG + Intronic
1144285695 17:13771687-13771709 ATGGATTAGCAGCTCCTCCATGG + Intergenic
1144384635 17:14738000-14738022 ATGTAAGCACAGCTAATCCAGGG + Intergenic
1144669390 17:17124451-17124473 ATGGATACACAGCTCATCCAGGG + Intronic
1150883723 17:69060890-69060912 CTAGAAACACAGTTCATCCATGG + Exonic
1154229072 18:12538094-12538116 AAGGATACACAGCTAGTCAATGG + Intronic
1158377555 18:56888357-56888379 AGGGATACATAGCTTACCCAAGG - Intronic
1161945789 19:7435644-7435666 ATGGATGCACAGCCCCTCCCAGG - Intronic
1161975820 19:7607372-7607394 AAGGTCACACAGCTCATTCAGGG - Intronic
1163856636 19:19707523-19707545 ATGGCTGCACAGCTCAGCAAAGG + Intergenic
1167449665 19:49559810-49559832 GAGGATAAACTGCTCATCCAGGG + Intronic
1167482442 19:49741426-49741448 ATGGAACCACAGCTCTTCCTGGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926669939 2:15567541-15567563 ATAGATATAAAGCTCATGCATGG + Intergenic
929562038 2:42962059-42962081 GTGACTACACAGCTCATCCCAGG - Intergenic
929631830 2:43470921-43470943 AAGGAAACAGAGCTCATCTATGG + Intronic
937103714 2:119291308-119291330 ATGGATACACAGCTTGTTCAAGG - Intergenic
939166461 2:138646187-138646209 ATGGTTAAACTGCTCATACAAGG + Intergenic
944887222 2:204075649-204075671 GTGCATACTCAGCTCATCCATGG - Intergenic
946214298 2:218172008-218172030 TTCGATACACAGCTCCCCCACGG - Intergenic
946467781 2:219927861-219927883 CTGGATACACAGGGCATCCTTGG + Intergenic
1169580297 20:7015284-7015306 ATGGATACACAGATCACAAATGG - Intergenic
1172810069 20:37641131-37641153 GTGGTCACACAGCACATCCATGG + Intergenic
1172914274 20:38432092-38432114 ATGTCTAGATAGCTCATCCAGGG - Intergenic
1173195791 20:40911780-40911802 TTGGATACACAGGTTCTCCAAGG - Intergenic
1175002769 20:55647701-55647723 ATGTTGACACAGCTCATTCATGG - Intergenic
1175810929 20:61856905-61856927 CTGGAAACACATCTCAGCCAGGG - Intronic
1176163813 20:63662569-63662591 ATGGATGCACAGCTGCTCCCGGG - Exonic
1177497046 21:21903181-21903203 ATGGACACACAGGTTCTCCAAGG - Intergenic
1178894615 21:36548463-36548485 ATCAATACGCAGCTCATCGAGGG + Intronic
1179039949 21:37793798-37793820 ATGGACACACAGCTTCTGCAAGG + Intronic
1181464545 22:23103834-23103856 CTGGCTACACAGGTCCTCCAGGG - Intronic
1184874482 22:47264811-47264833 GTGGATCCCCACCTCATCCATGG - Intergenic
950396118 3:12735384-12735406 GAGGCTACACGGCTCATCCAGGG + Intronic
950669020 3:14514096-14514118 AGGATTACACAGCTCACCCATGG - Intronic
951753993 3:26069017-26069039 ATGTAAACTCAGGTCATCCAAGG + Intergenic
951987447 3:28636372-28636394 TTGGATGCCCAGCTCCTCCATGG - Intergenic
953091797 3:39734733-39734755 ATGGGTACACAGGTCATTCACGG - Intergenic
953134317 3:40169553-40169575 AAGGCTACACAGCTCATAAATGG - Intronic
954454093 3:50587706-50587728 ATGCATTCAGAGCTCAGCCAAGG - Intergenic
954824176 3:53356861-53356883 ACGGATACACTGCTTATCCATGG + Intergenic
955780543 3:62479546-62479568 ATGCATACACAGCTACTGCAGGG + Intronic
956511789 3:70000959-70000981 ATGGCAACACAGCTTCTCCAGGG - Intergenic
957695580 3:83634735-83634757 ATGGATACAGAGCTCAGAGAGGG - Intergenic
957845942 3:85735450-85735472 ATGGAGACACAGGTCATGTAAGG + Intronic
959321074 3:104876673-104876695 AATGATATACAGCTCATGCATGG + Intergenic
960240766 3:115339206-115339228 ATGACTACAGAGCTCAACCAGGG - Intergenic
961705073 3:128778392-128778414 ATGTATGCACAGCATATCCACGG - Intronic
962909192 3:139832273-139832295 TTGGATTCAGAGCTCCTCCAAGG + Intergenic
963027268 3:140932433-140932455 ATGATTACCCAGTTCATCCAAGG - Intergenic
963843039 3:150127599-150127621 ATGGAGACACAGCCCAGCAATGG + Intergenic
965928139 3:174008366-174008388 ATTGATACAGAGCTCCTCCGTGG - Intronic
966502352 3:180657563-180657585 ATGAGTACACAGCTCATAAAAGG - Intronic
967681973 3:192374314-192374336 ATGACTACACAGGTGATCCATGG - Intronic
968571162 4:1341558-1341580 ATGGAGGCACAGCTCACCTACGG - Intergenic
968591190 4:1460359-1460381 ATGGGCACAGAGCTGATCCAGGG + Intergenic
969533861 4:7744044-7744066 ATGACTGCACAGCTCAACCAGGG + Intergenic
971903954 4:32701163-32701185 ATGGACACAAATCCCATCCATGG + Intergenic
972110141 4:35547721-35547743 ATGGATGCAAAGGGCATCCATGG + Intergenic
975533453 4:75424589-75424611 ATGGCAATATAGCTCATCCATGG - Intergenic
983026216 4:162740299-162740321 ATGGACACACAGGTTCTCCAAGG - Intergenic
987383911 5:17311577-17311599 ATGGACACACAGGTTCTCCAAGG + Intergenic
987586110 5:19859132-19859154 ATGGATGCTCACCTCAGCCAAGG + Intronic
988279423 5:29127028-29127050 ATGGACACACAGGTTCTCCAAGG + Intergenic
990448406 5:55914160-55914182 TTGGAGAGACAGCTCAACCAGGG - Intronic
991977414 5:72196750-72196772 AGGGGTAGACATCTCATCCATGG - Exonic
994214308 5:97120378-97120400 AAGGATACACACCCCATCCCTGG + Intronic
995932109 5:117458373-117458395 ATAAATACAGAACTCATCCAAGG - Intergenic
999280448 5:150361879-150361901 ATGGATAACCAGCCCATGCATGG - Intronic
1000156882 5:158561011-158561033 ATTGAGACACAGGTCATCCCAGG + Intergenic
1001060995 5:168488481-168488503 AAAGAAACACAGCTCATCAAAGG + Intronic
1002097076 5:176837698-176837720 CTAGCTACACAGCCCATCCATGG - Intronic
1002578458 5:180192264-180192286 ATGGAAACACAGCTCAGCAATGG + Intronic
1006008446 6:31021638-31021660 ATGGACACAGAGGTCCTCCAAGG - Intronic
1007605065 6:43112022-43112044 AAGGATAAACAGCTTGTCCAAGG + Intronic
1008461403 6:51778209-51778231 CAGGATACGCAGCTCATCCTTGG + Intronic
1011245115 6:85314381-85314403 ATGGACAGACACCTCATACAGGG - Intergenic
1012805205 6:103884844-103884866 TTGCAAACACAGCTCACCCAAGG + Intergenic
1013069801 6:106718124-106718146 AAAAATACACAGCTTATCCAAGG - Intergenic
1013570268 6:111416558-111416580 ATGGCAACACAGCTTATCTAAGG + Intronic
1013589747 6:111610084-111610106 AAGGTCACACAGCTCATCTATGG + Intergenic
1013785617 6:113776482-113776504 ATGGTTACATAGTTTATCCAGGG - Intergenic
1014153889 6:118089683-118089705 ATAGATCCACAACTCTTCCAAGG - Intronic
1015600468 6:134905488-134905510 ATGGACACACAGGTTCTCCAAGG - Intergenic
1018124196 6:160666048-160666070 ATGTATATTCAGATCATCCAAGG - Intergenic
1019000161 6:168743505-168743527 ATGGACACACAGGTTCTCCAAGG + Intergenic
1022022409 7:26413585-26413607 ATGGATATACAGCTTCTCCCTGG - Intergenic
1034192882 7:149224818-149224840 ATGGACGCCCAGCTCATCTAGGG + Exonic
1035122290 7:156578795-156578817 CTGGGTACACATCTCATCCATGG + Intergenic
1035567228 8:649728-649750 ATGGTCACACTGCTCAGCCAGGG - Intronic
1036414916 8:8538000-8538022 ATGCATTCATAGCTCATCCTTGG + Intergenic
1037425505 8:18750765-18750787 ATGGACACACAGGTTCTCCAAGG + Intronic
1038256685 8:25956923-25956945 AAGGAAACACCGCTCATCTAGGG + Intronic
1040460810 8:47646142-47646164 ATGAATACACAGTTCATAAAAGG + Intronic
1050331742 9:4552717-4552739 AAGGTTTCACAGCTAATCCATGG - Intronic
1053607602 9:39676916-39676938 ATAGTTACAAAGCTCACCCAGGG - Intergenic
1053865447 9:42433271-42433293 ATAGTTACAAAGCTCACCCAGGG - Intergenic
1054245932 9:62665488-62665510 ATAGTTACAAAGCTCACCCAGGG + Intergenic
1054560057 9:66700023-66700045 ATAGTTACAAAGCTCACCCAGGG + Intergenic
1056072148 9:82998535-82998557 AATAATACACAGCTCAGCCAGGG + Intronic
1056561823 9:87736848-87736870 ATGAATAGACAAATCATCCATGG + Intergenic
1056581398 9:87889860-87889882 CTGGTTACACAGCACATCTATGG + Intergenic
1056598310 9:88025827-88025849 ATGGAGAAACAGCTCTTCCCTGG - Intergenic
1057079035 9:92158605-92158627 ATGGATACTCAGCCCATGCTCGG + Intergenic
1060594111 9:124838338-124838360 ATGGATACAAAGGTTCTCCAAGG + Intergenic
1061520257 9:131113583-131113605 GGGGATACACAGCTCACCTAGGG - Intronic
1062554065 9:137106137-137106159 AAGGTGACACAGCACATCCACGG + Exonic
1185744110 X:2557855-2557877 ATGGTGATACTGCTCATCCATGG + Intergenic
1186085018 X:5978075-5978097 ATGTATGCACAGCTCATAAATGG + Intronic
1186764779 X:12759617-12759639 AAGGATGCTCAGCTGATCCAGGG - Intergenic
1187287047 X:17915661-17915683 GTGGATTCAAAGCTCATTCATGG + Intergenic
1188017986 X:25125817-25125839 AATTATACACAGCCCATCCATGG - Intergenic
1188574392 X:31629319-31629341 ATGAATAAACAGCTCTTCCGGGG - Intronic
1189570875 X:42295322-42295344 ATGGAATCACTGCTCATCAATGG - Intergenic
1189903010 X:45727353-45727375 AAGGATACAGAGATTATCCAGGG + Intergenic
1190779561 X:53580259-53580281 CTGGATCCACAGCCCAACCAAGG + Intronic
1190827508 X:54031200-54031222 ATGGACACTCAACTCTTCCAGGG + Intronic
1191174977 X:57489659-57489681 ATTCATACATAGCTCATCAATGG + Intergenic
1193633675 X:83922190-83922212 ATGGACACAAAGATCATTCATGG + Intergenic
1195675625 X:107505291-107505313 AAGGATACATGACTCATCCAGGG + Intergenic
1196714760 X:118800070-118800092 TTGGATACACAGGTTCTCCAAGG - Intergenic
1197496466 X:127188892-127188914 TAGGATATACAGCTCATCCAAGG - Intergenic