ID: 1144669411

View in Genome Browser
Species Human (GRCh38)
Location 17:17124559-17124581
Sequence GAACCACTGTGGAGGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 1, 2: 0, 3: 29, 4: 376}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144669411_1144669419 18 Left 1144669411 17:17124559-17124581 CCCCTCTGCCTCCACAGTGGTTC 0: 1
1: 1
2: 0
3: 29
4: 376
Right 1144669419 17:17124600-17124622 CACTCTAGTAACGAGTGCACTGG 0: 1
1: 0
2: 0
3: 2
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144669411 Original CRISPR GAACCACTGTGGAGGCAGAG GGG (reversed) Intronic
900137593 1:1124978-1125000 GAGCGGCTGTGGAGGCCGAGGGG + Intergenic
901013070 1:6211835-6211857 GAGCCAGTGTGGATGCAGGGGGG - Intronic
901066501 1:6497087-6497109 GCACCGCGGTGGGGGCAGAGCGG + Exonic
901660245 1:10794619-10794641 GAACTTGTGTGGAGGAAGAGGGG + Intronic
903252908 1:22069568-22069590 CAACTACTGGGGAGGCTGAGGGG - Intronic
904472593 1:30745382-30745404 GTGCCTCAGTGGAGGCAGAGAGG + Intronic
905002574 1:34684623-34684645 TAACTACTGTGGAGGAAGACCGG - Intergenic
905119633 1:35671887-35671909 CAGCCACTGGGGAGGCTGAGGGG - Intergenic
905252996 1:36661730-36661752 GAACCAGTCTAGAGACAGAGAGG - Intergenic
905409421 1:37757992-37758014 GATCCAGGGTGGAGACAGAGGGG - Intronic
905826241 1:41027997-41028019 GAAGGACTGAGGAGGGAGAGTGG - Exonic
905860833 1:41350049-41350071 GGACCCCTGTGGAGCCACAGGGG - Intergenic
905908281 1:41634387-41634409 AAACCACTGTGTGGGGAGAGGGG + Intronic
906197618 1:43938746-43938768 GAATCCGTTTGGAGGCAGAGAGG - Intergenic
908101748 1:60798253-60798275 TAAGCAATGGGGAGGCAGAGAGG + Intergenic
909519196 1:76547604-76547626 CAACCACTTGGGAGGCGGAGGGG + Intronic
910147012 1:84091949-84091971 GAGCCATAGTGGAGGTAGAGTGG + Intronic
911286091 1:95995023-95995045 GAACTAAATTGGAGGCAGAGAGG + Intergenic
912780845 1:112546203-112546225 CAACTACTCAGGAGGCAGAGTGG + Intronic
913190944 1:116412553-116412575 GAAAGACTGTGGAAGCAGAGTGG + Intergenic
914876033 1:151513180-151513202 ACACCACGGAGGAGGCAGAGGGG - Intronic
915426283 1:155829837-155829859 AAAGCATTGTGGAGTCAGAGGGG + Intronic
916073077 1:161183073-161183095 GAACAACAGTGTAGGCTGAGGGG - Intergenic
916184397 1:162116610-162116632 GGACAACTGTGGATGCAGTGAGG + Intronic
916323732 1:163534140-163534162 GTTCCGCTGTGGAGGGAGAGAGG + Intergenic
916625059 1:166546695-166546717 CAACCATTGTGGAGACAGTGTGG - Intergenic
917222047 1:172742323-172742345 GAACCACTCTTGAGTCAAAGTGG + Intergenic
919898646 1:202026499-202026521 CAGCCACTGGGGAGGCTGAGTGG + Intergenic
920202202 1:204266459-204266481 GGGCCACAGTGGAGCCAGAGTGG - Intronic
920292816 1:204935942-204935964 GAACCACAGTAAAGGCAGATTGG - Intronic
920785004 1:209032981-209033003 AAACTACGGTGGAGGCAGAGGGG + Intergenic
921210139 1:212888796-212888818 CAAAAACTCTGGAGGCAGAGGGG - Intronic
922032162 1:221812119-221812141 GTCCCAGTGTGGAGGCAGAAAGG - Intergenic
923100947 1:230816822-230816844 GAGAAACTGTGGAGGAAGAGAGG + Intergenic
923219144 1:231877011-231877033 GGGCCACTCTGGAGGGAGAGCGG + Intronic
923391334 1:233516081-233516103 GAACCATAGTGGAGGCAGACAGG + Intergenic
924264356 1:242266775-242266797 GTAGAAATGTGGAGGCAGAGAGG + Intronic
1062937838 10:1401204-1401226 GACCCACTGTGGAGGCAGCCGGG + Intronic
1063558072 10:7099655-7099677 GAACCAGGGTGAAGTCAGAGAGG - Intergenic
1066292883 10:34029867-34029889 GACACACTGTGGTGGCTGAGTGG - Intergenic
1066720449 10:38331711-38331733 GTAGAAATGTGGAGGCAGAGTGG - Intergenic
1066982603 10:42432295-42432317 CAACCATTGTGGAGACAGTGTGG - Intergenic
1068232114 10:54181541-54181563 GGACTACTATGGAGGGAGAGAGG - Intronic
1068612328 10:59073758-59073780 GAACAACTTTGAAGACAGAGAGG - Intergenic
1069720316 10:70545407-70545429 GTACTGCTGTGGAGGCAAAGGGG + Intronic
1070981627 10:80653031-80653053 CAACCTCTGGGGAGGGAGAGGGG - Intergenic
1071602354 10:86964551-86964573 CATCCACTGAGGAGGCAGAACGG + Intronic
1072422034 10:95297301-95297323 AAGCAACTGTGGAGGCAGAAAGG + Intergenic
1073567295 10:104546058-104546080 GTACAACTGAGGAGTCAGAGAGG - Intergenic
1073622464 10:105063389-105063411 GAATCACTGTGTAGACAAAGTGG + Intronic
1075677139 10:124303561-124303583 GAGGCACTGTAGAGGCAGGGAGG - Intergenic
1075682263 10:124341432-124341454 GCAACACTGTGGAGGCAATGGGG + Intergenic
1075742582 10:124704889-124704911 GAACCAGGGTGGTGGCAGCGGGG + Intronic
1075906190 10:126083796-126083818 GCACCGCTGGGCAGGCAGAGTGG - Intronic
1076805488 10:132856125-132856147 GGACCTCTGTGAAGGCCGAGAGG - Intronic
1076817177 10:132920710-132920732 GAACCCCTGTGCTGGCCGAGAGG - Intronic
1077018925 11:408939-408961 GGACCACTGTGGAGGTGGTGGGG - Intronic
1078452602 11:11451629-11451651 GCACCAGTGAGGAGGAAGAGAGG - Intronic
1078911993 11:15741179-15741201 GAACCATTTTGGAGGAAGAGGGG - Intergenic
1079153691 11:17924578-17924600 GAAGCACTGTGGTGGCAGTGTGG + Intronic
1080236062 11:30069710-30069732 GATGCACTTTGCAGGCAGAGAGG - Intergenic
1080873831 11:36259335-36259357 GAACCACTGTGCTGGTGGAGAGG + Intergenic
1081942222 11:46953383-46953405 GAACCATTGTACAGGGAGAGAGG + Intronic
1082758623 11:57104015-57104037 GAACAGCCCTGGAGGCAGAGAGG - Intergenic
1083185813 11:61017347-61017369 GGACAACTCCGGAGGCAGAGAGG - Intronic
1083327159 11:61878629-61878651 GAAGCCCTGTGGAGGAGGAGGGG + Exonic
1086736215 11:90308319-90308341 CAACCATTGTGGAAGCAGTGTGG + Intergenic
1087083050 11:94190229-94190251 CAACCACTGTGGAGACAATGTGG - Intergenic
1087571069 11:99928382-99928404 GAACCTCTGCTGAGGCAGTGTGG - Intronic
1089004983 11:115083825-115083847 GAGGCAGTGTGGAGGCACAGTGG - Intergenic
1089008328 11:115112142-115112164 AAACCACAGTGGAGGGAGTGGGG - Intergenic
1089165781 11:116475467-116475489 GAACCAGCAAGGAGGCAGAGTGG + Intergenic
1089179843 11:116575691-116575713 CAACCATTGTGGAGTCAGTGTGG + Intergenic
1090472269 11:126990646-126990668 GGGCAACTGCGGAGGCAGAGAGG - Intronic
1091062559 11:132477336-132477358 GTACCACTGTGCAGGAAGAGTGG - Intronic
1091557727 12:1587886-1587908 GAACCCCTGAGGAGTCAGAGGGG - Intronic
1091562792 12:1627755-1627777 AAACCACTGTGTAGGCAGGATGG - Intronic
1091597479 12:1887891-1887913 TAACCACTGTGGAGGAGGAAGGG - Intronic
1091916512 12:4274410-4274432 GATAAACTGGGGAGGCAGAGGGG + Intronic
1091992328 12:4965419-4965441 GAACAACTGTGGAGGCACTTTGG + Intergenic
1092767271 12:11863888-11863910 CAACCACTGTCAAGGCTGAGAGG - Intronic
1094322395 12:29199652-29199674 GCAGCAGTGTGGAGGCAGAATGG + Intronic
1095052860 12:37569554-37569576 ATAGCACTTTGGAGGCAGAGGGG - Intergenic
1096062854 12:48716661-48716683 GAAGCACTATGGAGGGAGAGAGG - Exonic
1096158449 12:49356070-49356092 CAACTACTCTGGAGGCTGAGTGG + Intronic
1096259874 12:50083786-50083808 GAACCACTGGGCAGGGAAAGAGG + Intergenic
1096842897 12:54390253-54390275 GGACTATTGTGGAGGCAGGGTGG + Intronic
1098551268 12:71763870-71763892 AAACCATTGTGGAGTCAGACAGG + Intronic
1098761867 12:74435029-74435051 GAACCTCTGTGAGGGCAGTGTGG + Intergenic
1099325348 12:81208293-81208315 GAACCACTGTAAAGGCAGAATGG + Intronic
1099528309 12:83742740-83742762 CAACCATTGTGGAGACAGTGTGG + Intergenic
1099760308 12:86912491-86912513 GAACCTCTGTTAAGGCAGTGTGG + Intergenic
1100665278 12:96745259-96745281 CAACCACTGTGGAGACAGTGTGG - Intronic
1100880478 12:99010450-99010472 GAACCACTGGGGAAGGAGTGAGG + Intronic
1101192364 12:102348196-102348218 GAATCACTGTGGCAGCAGAGAGG + Intergenic
1101490980 12:105209225-105209247 ACACCACTGTCTAGGCAGAGGGG + Intronic
1106493643 13:30253257-30253279 GAGTCACTGTGGAAACAGAGGGG - Intronic
1106937061 13:34734702-34734724 TAACCTCTGTGGAGGAACAGAGG + Intergenic
1109552943 13:63929603-63929625 CAACCACTCAGGAGGCTGAGAGG - Intergenic
1112226929 13:97548886-97548908 GAAACATTCTGGAGGCAGAAGGG + Intergenic
1112783100 13:102923525-102923547 GAACCACCGTGGAGAGAGAAGGG + Intergenic
1113999639 14:16401715-16401737 TAGCTACTGTGGAGGCTGAGTGG - Intergenic
1114656429 14:24318625-24318647 GAACCACATTGGAGGCATAGGGG - Intronic
1114852925 14:26402144-26402166 GAATCAATGGGGAGGAAGAGAGG - Intergenic
1114960330 14:27879450-27879472 CAACCATTGTGGAGACAGTGTGG - Intergenic
1115094224 14:29615628-29615650 GAATCGCTGTGGAAGCACAGTGG - Intronic
1117346023 14:54833624-54833646 GAAACAGTGTGGGGGTAGAGTGG - Intergenic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1119841927 14:77799981-77800003 GCAGTACTGTGGAGGCACAGGGG - Intergenic
1119862843 14:77948901-77948923 GAACCAATTTGGTGGCAGAGGGG - Intergenic
1119889742 14:78173908-78173930 GAGCCATGGTGGAGGTAGAGTGG - Intergenic
1120071050 14:80103048-80103070 GTAGCACTGCGGAGGCAGAAGGG + Intergenic
1120493900 14:85210124-85210146 GAACAACTTAGAAGGCAGAGTGG + Intergenic
1120748392 14:88174620-88174642 AAACTAGTGTGAAGGCAGAGGGG - Intergenic
1122281913 14:100628645-100628667 GAGGCCCTGTGAAGGCAGAGGGG + Intergenic
1122518674 14:102327063-102327085 GAGTCACGGTGAAGGCAGAGTGG + Intronic
1123062276 14:105599682-105599704 GACCCAGAGTGGGGGCAGAGAGG + Intergenic
1123903933 15:24903782-24903804 CCATCACTTTGGAGGCAGAGAGG + Intronic
1123993418 15:25701615-25701637 GCTCCACTGTGGAAGCACAGGGG + Intronic
1125320457 15:38482256-38482278 GAGCCACAGTGGAAGCACAGAGG - Intronic
1126017174 15:44363612-44363634 CAACCATTGTGGAAGCAGTGTGG + Intronic
1126919101 15:53500599-53500621 CAACCACTGTGGAAACAGTGTGG - Intergenic
1127398030 15:58558688-58558710 GGACCAGTGTGGGGGCAGGGGGG - Intronic
1128054337 15:64688656-64688678 GAGCCACAGTGGGGGAAGAGGGG - Exonic
1128691484 15:69727674-69727696 AAACCACTGAGGAGGCAGGGTGG - Intergenic
1129334171 15:74842722-74842744 GAGCCAGTTGGGAGGCAGAGTGG - Intronic
1129415214 15:75373009-75373031 GTAACACAGTGGAGGGAGAGTGG - Intronic
1130515353 15:84622086-84622108 GAATCACTGTTGGGGCAGTGTGG - Exonic
1130783378 15:87069214-87069236 CAACCACTATGGAGGTACAGAGG - Intergenic
1130832507 15:87615972-87615994 GAAACCTTGGGGAGGCAGAGAGG - Intergenic
1132345974 15:101109018-101109040 CAGCCAGTGTGGATGCAGAGTGG - Intergenic
1202965770 15_KI270727v1_random:175617-175639 CAGCCACTGGGGAGGCTGAGGGG + Intergenic
1133073503 16:3262616-3262638 GAACCACTGTGGAGGCAGAAGGG + Intergenic
1133858239 16:9569844-9569866 CAACCACTATGGAGGCAGAATGG + Intergenic
1133944663 16:10338151-10338173 CAACTACTGGGGAGGCTGAGGGG + Intronic
1134228183 16:12408332-12408354 GCACCACAGTGGACCCAGAGAGG - Intronic
1135644513 16:24150011-24150033 CTACCACTGTGCAGGCAAAGAGG - Intronic
1135870447 16:26145055-26145077 GACCCACTGTGGAGGCAAGCAGG - Intergenic
1136109693 16:28057070-28057092 GAGTGACTGTGGGGGCAGAGAGG + Intronic
1136652482 16:31684723-31684745 CAACCTCTGAGGAGGGAGAGAGG + Intergenic
1136672031 16:31867027-31867049 CAACCTCTGAGGAGGCAGAGAGG - Intergenic
1137556523 16:49473815-49473837 GGGCCACCTTGGAGGCAGAGTGG - Intergenic
1137625232 16:49903519-49903541 TCACCAGTTTGGAGGCAGAGGGG - Intergenic
1137706638 16:50539987-50540009 GGACCTCAGCGGAGGCAGAGAGG + Intergenic
1138127410 16:54450048-54450070 GAACTACTCTGCAGGGAGAGAGG + Intergenic
1138276654 16:55740079-55740101 AAACAACTGTGGACACAGAGAGG + Intergenic
1138392144 16:56677581-56677603 GGCCCACTGTTGGGGCAGAGAGG + Intronic
1138582169 16:57948764-57948786 GAAACACTATGGAGGGTGAGTGG - Intronic
1141261891 16:82462057-82462079 GTACCCCTGTGGAGGTAGGGAGG - Intergenic
1141422453 16:83925789-83925811 GATGAACTTTGGAGGCAGAGTGG - Exonic
1141822488 16:86456480-86456502 GAATGAGTGGGGAGGCAGAGTGG - Intergenic
1142168649 16:88607982-88608004 TAACCAGTTAGGAGGCAGAGTGG - Intronic
1143011958 17:3870859-3870881 GTACAACTGTGGAGGCAGGGAGG + Intronic
1143136007 17:4712601-4712623 GGATCACTGCTGAGGCAGAGTGG + Intronic
1143256539 17:5561928-5561950 GAAACACTCTGAAGGCAGGGTGG + Intronic
1144669411 17:17124559-17124581 GAACCACTGTGGAGGCAGAGGGG - Intronic
1145202997 17:20963620-20963642 GAAACAGGGTAGAGGCAGAGTGG - Intergenic
1145373381 17:22325487-22325509 ATAGCACTTTGGAGGCAGAGGGG - Intergenic
1146520175 17:33520239-33520261 GAAACACTGTCCAGGCAGAAAGG + Intronic
1147911614 17:43859420-43859442 CGTCCACAGTGGAGGCAGAGGGG + Intronic
1148447750 17:47749529-47749551 TAACTACTGGGGAGGCTGAGTGG - Intergenic
1148843514 17:50514769-50514791 CAACCACTTGGGAGGCTGAGGGG - Intronic
1149613102 17:57972275-57972297 GGACCACTGTGGAGGAAGCCTGG + Intronic
1150569114 17:66370159-66370181 GTGCCACTGTGGAGGTTGAGGGG - Intronic
1151359315 17:73579053-73579075 GAACCAGTGAGGATGCCGAGGGG - Intronic
1152632760 17:81417921-81417943 GAAGCAGTGTGGGGGCAGCGAGG - Intronic
1153451556 18:5236421-5236443 GCTCCACTGTGGAGGCAAAAAGG + Intergenic
1155605924 18:27606050-27606072 GGACCACTCAAGAGGCAGAGGGG + Intergenic
1156992135 18:43421716-43421738 CATTCACTGAGGAGGCAGAGAGG - Intergenic
1157191580 18:45586550-45586572 GAACAAGAGTGGAGGCAGAATGG + Intronic
1157426873 18:47591651-47591673 GAAGCAGGGTGGAGGCAGGGAGG + Intergenic
1157674751 18:49560943-49560965 CAACCACTGCGGACGCAGGGCGG - Intronic
1158519764 18:58162159-58162181 GAACCACTGTGGCTGCTGTGAGG - Intronic
1160833503 19:1113934-1113956 CTACCCCTGTGGAGGCAGTGAGG - Intronic
1161309810 19:3587238-3587260 GAACCACTTTGGAGCCAGGCTGG + Intronic
1162001675 19:7748170-7748192 CATGCACTGTGGAGGCAGACTGG - Intergenic
1164217539 19:23162979-23163001 CAACCACTGTGGGGGTAGGGTGG + Intergenic
1164835681 19:31353704-31353726 GCACCACTATGGAGGAGGAGCGG - Intergenic
1166617378 19:44262320-44262342 GGTCCTCTCTGGAGGCAGAGTGG + Intronic
1166643633 19:44514924-44514946 GAATCACTTGGGAGGCAGCGAGG - Intronic
1167577630 19:50325440-50325462 CAACCCCTGTGGAGGAAGGGGGG - Intronic
1167795079 19:51703683-51703705 CAGCCACTGGGGAGGCTGAGCGG + Intergenic
926418028 2:12669903-12669925 GAACAACTGGGGAGGAAGATAGG + Intergenic
926542598 2:14199936-14199958 ATTACACTGTGGAGGCAGAGGGG + Intergenic
926748826 2:16182003-16182025 GACACACTGGGGAGGCAGAGTGG + Intergenic
927420245 2:22923629-22923651 GTATCCCTGTGGAGGCTGAGAGG + Intergenic
928909856 2:36408585-36408607 GAACCCCTGTGGACACAGAAGGG - Intronic
930293293 2:49522598-49522620 GAACCACTGTGCACACAGAAAGG + Intergenic
930544141 2:52745812-52745834 GAACCTCTGTAAAGGCAGTGTGG + Intergenic
931308386 2:61055008-61055030 CCACCACTTTGGGGGCAGAGAGG - Intergenic
931769818 2:65487849-65487871 GAACAACTGGGGAGTCAAAGGGG - Intergenic
932151712 2:69379147-69379169 GAACCTGTGTGGAGACAGAAAGG - Intronic
932699248 2:73982194-73982216 AAACTTCTGTGGAGGGAGAGTGG + Intergenic
934566174 2:95342790-95342812 CAATCACTGTGGCAGCAGAGGGG + Intronic
935119910 2:100175412-100175434 GAAGAACTCTGGAGGCAGAAAGG + Intergenic
935784204 2:106534091-106534113 GAACCACTGTGGGTGGAGCGAGG + Intergenic
935983788 2:108652883-108652905 GAAACAGTGAGGAGGCAGGGAGG - Intronic
936136222 2:109896537-109896559 GAAACAGTGAGGAGGCAGGGAGG - Intergenic
936208475 2:110474948-110474970 GAAACAGTGAGGAGGCAGGGAGG + Intergenic
936972842 2:118191557-118191579 GAAGTGTTGTGGAGGCAGAGGGG + Intergenic
939757996 2:146137544-146137566 GAACCTCTGCTGAGGCAGTGCGG - Intergenic
939846796 2:147256179-147256201 GAGGCACCATGGAGGCAGAGTGG + Intergenic
940247704 2:151637334-151637356 GCACCACTGTGGAGGGGAAGCGG + Intronic
940253771 2:151707863-151707885 GATGCTCTGTGGAGGCTGAGGGG - Intronic
940449897 2:153824293-153824315 CAACCACTGTGGAAGCAGTTTGG + Intergenic
940898145 2:159101027-159101049 GACCCACTGTGGGGCCAGCGTGG - Intronic
943439961 2:187916232-187916254 AAAACCCTGTGAAGGCAGAGAGG - Intergenic
945069438 2:205976271-205976293 GAACCACTGAGGAGCCCCAGGGG - Intergenic
945940643 2:215946085-215946107 GAACCACTTTGCAGGCTGGGAGG - Intronic
946178671 2:217937332-217937354 GACCCACTGTGGACGCTGTGCGG - Intronic
946315601 2:218909351-218909373 GGAGCACGGTGGAGGCAGGGGGG - Intergenic
946891013 2:224276426-224276448 GAGCCATTGTGGAAGCAGAGAGG + Intergenic
947362524 2:229360799-229360821 TAACCAGTGTGGACACAGAGTGG - Intronic
947833572 2:233159222-233159244 AACCCACTGTGGGGGCACAGAGG - Intronic
1169608506 20:7351370-7351392 GAACCACTGAGATGACAGAGAGG - Intergenic
1170940657 20:20845562-20845584 GAACCACTATGGAAGGGGAGGGG + Intergenic
1171529413 20:25842835-25842857 ATAGCACTTTGGAGGCAGAGGGG + Intronic
1171547413 20:26013045-26013067 ATAGCACTTTGGAGGCAGAGGGG - Intergenic
1171751199 20:29050753-29050775 TAGCTACTGTGGAGGCTGAGTGG + Intergenic
1171791779 20:29533179-29533201 TAGCTACTGTGGAGGCTGAGTGG - Intergenic
1171856563 20:30349704-30349726 TAGCTACTGTGGAGGCTGAGTGG + Intergenic
1173205851 20:40992531-40992553 GATGCACTCTGGAGGAAGAGAGG - Intergenic
1174289469 20:49497500-49497522 GAACCACTGTGTAGGCAGCCAGG + Intergenic
1175065083 20:56277414-56277436 GAACAACAGGGGAGGCAGACAGG + Intergenic
1175519032 20:59587922-59587944 GAATCACTCAGGAAGCAGAGGGG - Intronic
1175812893 20:61868343-61868365 GGACCTCTGAGGAGTCAGAGGGG + Intronic
1176109762 20:63405930-63405952 GAACCAAACTGGAGCCAGAGTGG - Intergenic
1176910622 21:14560743-14560765 GAACCATTGTGAAGCAAGAGAGG - Intronic
1176910792 21:14562153-14562175 GAACCATTGTGAAGCAAGAGAGG + Intronic
1176918488 21:14656574-14656596 GAAAAATTGTGGAGTCAGAGTGG + Intronic
1179632369 21:42686439-42686461 CATCACCTGTGGAGGCAGAGAGG - Intronic
1179655063 21:42839713-42839735 AAACCACCGTGGATGCAGCGGGG - Intergenic
1180144470 21:45911466-45911488 AAACCACCGTGGAGGAACAGAGG + Intronic
1180391403 22:12286283-12286305 TAGCTACTGTGGAGGCTGAGTGG - Intergenic
1180408340 22:12578471-12578493 TAGCTACTGTGGAGGCTGAGTGG + Intergenic
1180628246 22:17208940-17208962 GAGCTACTCTGGAGGCTGAGTGG - Intronic
1180783942 22:18536613-18536635 GGACCAGGGTGGAGGCGGAGGGG - Intergenic
1180820318 22:18822688-18822710 GAACCAAGGTGACGGCAGAGAGG + Intergenic
1182129127 22:27838041-27838063 GACCCATTGGGGAGGCAGATTGG + Intergenic
1183329755 22:37212827-37212849 GGACCACTGGGGAGGCCGGGTGG + Intergenic
1185082639 22:48718337-48718359 GAGCCTCTGTGGGGGCAGCGGGG + Intronic
1203220377 22_KI270731v1_random:38263-38285 GAACCAAGGTGACGGCAGAGAGG - Intergenic
1203270448 22_KI270734v1_random:48563-48585 GAACCAAGGTGACGGCAGAGAGG + Intergenic
949415568 3:3810314-3810336 ATATCACAGTGGAGGCAGAGAGG - Intronic
949876548 3:8629628-8629650 GAACCACTGGTGAGTCAGTGAGG - Intronic
949906740 3:8864226-8864248 GCACCCCTGTGGAGAGAGAGGGG - Intronic
951215567 3:20021680-20021702 CAACCACTTGGGAGGCTGAGAGG + Intergenic
953103185 3:39850244-39850266 GACCCACAGGGGAGGCAGAAGGG - Intronic
953888965 3:46736422-46736444 TAACGGATGTGGAGGCAGAGGGG + Exonic
955358358 3:58250588-58250610 GACCCAGTGTGGTGGCTGAGGGG + Intronic
955742783 3:62109871-62109893 GAAACTCTGTGGAGTGAGAGCGG - Intronic
956731207 3:72198255-72198277 GAACAACTGGGGAGGAAGAATGG - Intergenic
956977901 3:74602984-74603006 AAACTACTGTAAAGGCAGAGGGG + Intergenic
957919184 3:86726597-86726619 GAACCAATTTTGAGGCTGAGAGG + Intergenic
958098532 3:88978902-88978924 TAGCTACTCTGGAGGCAGAGGGG - Intergenic
958775543 3:98478555-98478577 CAACCATTGTGGAAGCAGTGTGG - Intergenic
959213409 3:103418536-103418558 CAACCATTGTGGAAGCAGTGTGG + Intergenic
960286795 3:115839013-115839035 GAAGCACTGTGTGGGCAGCGGGG - Intronic
960397548 3:117155695-117155717 AAAACAATGTGGAGGGAGAGAGG + Intergenic
960949613 3:122990711-122990733 GAACCCCTGTGGGGTCACAGGGG - Intronic
961382540 3:126505301-126505323 GAACAGGTGGGGAGGCAGAGAGG - Intronic
962288156 3:134105917-134105939 GATGAAGTGTGGAGGCAGAGAGG - Intronic
962382752 3:134910677-134910699 GAGCATCTGTGGAGTCAGAGGGG + Intronic
964384203 3:156129958-156129980 GATCCACTGTGCATGGAGAGAGG - Intronic
966252962 3:177887455-177887477 GCATCTCTGTGGTGGCAGAGTGG - Intergenic
967318170 3:188169980-188170002 GATAGACTGTGTAGGCAGAGAGG + Intronic
967681839 3:192372621-192372643 GAACAAAGGTGGAGGCAGTGCGG - Intronic
967998366 3:195183840-195183862 GAACCAGTGTGAAGGCTGAATGG + Intronic
968182894 3:196610270-196610292 GTACCACAGTAGAGGCAGCGTGG + Intergenic
968816200 4:2823181-2823203 GAGGCACTGTGGAGGCTGGGCGG - Intronic
972775488 4:42236015-42236037 GAAACACTTTGGAAACAGAGAGG + Intergenic
974854830 4:67448270-67448292 GAACCGCTGGGGAGAGAGAGAGG + Intergenic
977914188 4:102572528-102572550 CAGCCACTGTGGAAGCAGTGTGG - Intronic
978713113 4:111809446-111809468 CAGCCTCTTTGGAGGCAGAGTGG - Intergenic
980072801 4:128261283-128261305 CAACCACTGTGGTGGGAGGGGGG - Intergenic
981550782 4:145938456-145938478 AAACCCCCGTGGGGGCAGAGAGG + Exonic
981749335 4:148078393-148078415 GAACAACTTTGGAGTCAGACGGG + Intergenic
983317063 4:166145851-166145873 CAACCACTCTGAAGGCAGATGGG - Intergenic
983467533 4:168113476-168113498 GCACCATTGTGGAAGCAGACTGG - Intronic
983706900 4:170672582-170672604 GAACAAATCTGGGGGCAGAGAGG - Intergenic
985433565 4:189905159-189905181 TAGCTACTGTGGAGGCTGAGTGG + Intergenic
985485541 5:146353-146375 GAACCACTGTGGGGGTGGAGAGG - Intronic
985983009 5:3488118-3488140 GAACCCCCAGGGAGGCAGAGAGG + Intergenic
986122968 5:4859234-4859256 GAACCACTGTGTGAGCAGAGGGG + Intergenic
986546872 5:8907274-8907296 AAACCACTGTAGAGGCACAAAGG + Intergenic
986723340 5:10576308-10576330 GAACCACAGTGAAGGCAGCCAGG - Intronic
988994509 5:36701793-36701815 GAACAATTGGGGAGGGAGAGGGG + Intergenic
989570626 5:42943000-42943022 GAGCTACTCTGGAGGCTGAGAGG + Intergenic
990093179 5:52081318-52081340 GAGCTATTCTGGAGGCAGAGAGG + Intergenic
990626061 5:57612740-57612762 GAACCACAGAGGAAGGAGAGGGG - Intergenic
991631889 5:68664770-68664792 CAGCCACTTGGGAGGCAGAGAGG + Intergenic
991950121 5:71939182-71939204 GAGCCACCGGGCAGGCAGAGTGG + Intergenic
992169471 5:74087544-74087566 GAAGCCCTGTGGAGGCAGGTAGG - Intergenic
992319462 5:75597454-75597476 GAACATCTGTGAAGGCACAGTGG + Intronic
995015896 5:107308222-107308244 GAATCACTTTGTTGGCAGAGGGG - Intergenic
995015943 5:107309100-107309122 GAATCACTTTGTTGGCAGAGGGG - Intergenic
995055859 5:107757998-107758020 GAACCACTGAGGATGCTGGGAGG + Intergenic
996021411 5:118594738-118594760 GAAACACTGTCAGGGCAGAGGGG + Intergenic
996396706 5:123021084-123021106 GGAACTGTGTGGAGGCAGAGAGG - Intronic
998623809 5:143823302-143823324 GGACCACTGTGGTTGCAGTGTGG - Intergenic
999098773 5:149005061-149005083 GGACCACAGTGGAGGGAGAGAGG - Intronic
999205991 5:149848414-149848436 TTACCAGTGAGGAGGCAGAGCGG + Exonic
999219333 5:149961496-149961518 GAAACACTGAGAAGACAGAGAGG + Intronic
1000627925 5:163560412-163560434 TAACCACTTGGGAGGCTGAGTGG - Intergenic
1001072889 5:168602071-168602093 TAACCTATGTGAAGGCAGAGAGG - Intergenic
1001457086 5:171871846-171871868 GAACTACTTTGGAGTCATAGTGG - Intronic
1002624054 5:180512240-180512262 GACCCACTGTGGAGGCTAGGTGG + Intronic
1003499893 6:6695392-6695414 GACCCACTGGGGAGGCAGCCTGG + Intergenic
1003536551 6:6980531-6980553 GAACCACTCTCTAGGCAGAAAGG - Intergenic
1003679176 6:8235271-8235293 GAAGAACTGAGGAGGCAGACAGG + Intergenic
1006249236 6:32766483-32766505 GAAACACTGTAGAGTCAGAAAGG + Intergenic
1007829494 6:44627625-44627647 GAACCACTGGGGAGGGGGAGGGG - Intergenic
1007916606 6:45567175-45567197 GAAATGCTGCGGAGGCAGAGGGG + Intronic
1008067277 6:47062648-47062670 GAAACACTCTGGAAGGAGAGGGG + Intergenic
1011574785 6:88784392-88784414 GGAATACTGTGGAGGCACAGGGG + Intronic
1012121768 6:95377767-95377789 GGGCCACAGTGGAAGCAGAGAGG - Intergenic
1013890513 6:115021086-115021108 GAACCTCTGTTAAGGCAGTGTGG - Intergenic
1014637282 6:123863142-123863164 AGAGCCCTGTGGAGGCAGAGGGG + Intronic
1014918884 6:127188938-127188960 GAAATAATGTGGAGGCAGAAGGG + Intronic
1015575465 6:134666370-134666392 GAACCTCCCTGCAGGCAGAGAGG + Intergenic
1015876616 6:137828934-137828956 GAACCACTGTTGAGGGAGCAGGG - Intergenic
1018744860 6:166754360-166754382 GAGCCTGTCTGGAGGCAGAGGGG + Intronic
1019199031 6:170298874-170298896 CAACCACTCTCCAGGCAGAGGGG + Intronic
1019221863 6:170479444-170479466 AGAGCAGTGTGGAGGCAGAGTGG - Intergenic
1020022855 7:4879321-4879343 GAACCTCTGTGGGGGCAGGAGGG + Intronic
1020404509 7:7816793-7816815 GAACCACTGTAGTTGCAGTGGGG - Intronic
1020767349 7:12340384-12340406 GAACCACCATTGAGGCAGACAGG + Exonic
1022036536 7:26539873-26539895 GGGCCACTGTGGAGGCAGCAGGG + Intergenic
1022592890 7:31682968-31682990 GGACCACTGTGGAGTCTGGGAGG + Intergenic
1022618118 7:31953320-31953342 GCTCCACTCTGAAGGCAGAGGGG + Intronic
1023073305 7:36458986-36459008 GAGCCATTGGGAAGGCAGAGAGG + Intergenic
1023748296 7:43343829-43343851 CAACCATTGTGGAGACAGTGTGG - Intronic
1023763928 7:43493244-43493266 ACACCTCTGTGGAGACAGAGCGG + Intronic
1023862284 7:44223884-44223906 GAACCCCTGTGGAGTGGGAGGGG - Intronic
1023999539 7:45181527-45181549 GAATGACTTTGGAGGCACAGAGG + Intronic
1024231513 7:47367293-47367315 GAAACACTCAGCAGGCAGAGAGG - Intronic
1024631045 7:51247275-51247297 GCACCACTGAGAAAGCAGAGTGG - Intronic
1026228809 7:68465752-68465774 AAACCACAGGGGAAGCAGAGTGG + Intergenic
1026451567 7:70533942-70533964 CAACCATTGTGTAGGCAGAGTGG - Intronic
1026671763 7:72397022-72397044 TAGCCACTTTGGAGGCTGAGGGG - Intronic
1026735220 7:72945009-72945031 GAAACAGTGTGGAAGCAGCGTGG + Intronic
1026785562 7:73299938-73299960 GAAACAGTGTGGAAGCAGCGTGG + Intergenic
1026843577 7:73684411-73684433 CAACTACTGGAGAGGCAGAGGGG - Intronic
1027340553 7:77203143-77203165 GAACCAGTGTGGAGGCAGGAGGG + Intronic
1030196533 7:106858768-106858790 GAACCGCTATGGCAGCAGAGGGG + Intergenic
1033229214 7:139583573-139583595 GAGCCATTGTAAAGGCAGAGAGG + Intronic
1033573706 7:142659139-142659161 GAAGCAATGAGGAGGGAGAGGGG - Intergenic
1034199730 7:149276608-149276630 GAACCTCAGTTGAGGTAGAGTGG + Intronic
1034972348 7:155427196-155427218 GAAGCTCCCTGGAGGCAGAGTGG - Intergenic
1035731840 8:1859100-1859122 GAAACACCGTGCAAGCAGAGAGG - Intronic
1035731842 8:1859140-1859162 GAAACACCGTGTAAGCAGAGAGG - Intronic
1035731864 8:1859309-1859331 GAAACACCGTGTAAGCAGAGAGG - Intronic
1037659719 8:20916347-20916369 GCACCAGGGTGGTGGCAGAGAGG - Intergenic
1037710741 8:21353475-21353497 GTACCACTGGGGAGGCTGGGAGG + Intergenic
1038144480 8:24882298-24882320 GATCCATTGTGGTTGCAGAGTGG - Intergenic
1042955916 8:74250516-74250538 TAACCACTGAGGAAGCAGGGGGG - Intronic
1045533599 8:103006609-103006631 CAACCTATGGGGAGGCAGAGGGG - Intergenic
1045739594 8:105340991-105341013 GAACCACTGTCAAGGGTGAGGGG + Intronic
1045832464 8:106480087-106480109 GAACCACTGTGGGGTAACAGAGG - Intronic
1046671352 8:117059929-117059951 GAGCTAGTGTGGAGGCAGAGGGG + Intronic
1047801357 8:128313919-128313941 CAACCACTGTGGTGGGAAAGGGG - Intergenic
1047914839 8:129571951-129571973 GAAGCTGTGAGGAGGCAGAGAGG - Intergenic
1048466105 8:134665848-134665870 GGACCTCAGGGGAGGCAGAGGGG - Intronic
1048719084 8:137301609-137301631 GAACCACTATGGAGGCATCCAGG + Intergenic
1048799390 8:138182084-138182106 GTGCCACTGTGGTGGCAGCGTGG - Intronic
1049494761 8:142924480-142924502 GGTGCACTGTGGAGGAAGAGGGG + Intergenic
1049785915 8:144450765-144450787 GGACCTCTGTGGAGACAGACAGG + Exonic
1050403486 9:5282198-5282220 CAACCATTGTGGAAGCAGAGTGG + Intergenic
1050629329 9:7542121-7542143 AAACCACTCTGGAGGAAGAAGGG + Intergenic
1050697782 9:8298261-8298283 GAACCTCTGAGGAGGAAGACAGG + Intergenic
1051633703 9:19163024-19163046 CAACTACTTGGGAGGCAGAGGGG - Intergenic
1051807910 9:21016640-21016662 GAACCACTGGGGGGCTAGAGGGG + Intronic
1052303990 9:26984874-26984896 CAACCACTGTGAAAGCAGTGTGG + Intronic
1052866281 9:33466420-33466442 GAACACCTGTGGAAGAAGAGGGG + Exonic
1052886309 9:33651516-33651538 GAAGCAATGAGGAGGGAGAGGGG - Intergenic
1053722685 9:40963229-40963251 TAGCTACTGTGGAGGCTGAGTGG + Intergenic
1054343280 9:63888768-63888790 TAGCTACTGTGGAGGCTGAGTGG - Intergenic
1055219237 9:73908218-73908240 GAAACAAGGTGGAGGGAGAGTGG + Intergenic
1056285665 9:85085169-85085191 GCACCAATGTGGTGGCAGAAAGG + Intergenic
1056677913 9:88692022-88692044 GCACCACTGGGGTGGCAGATAGG + Intergenic
1056737699 9:89223934-89223956 GGAACACTGTGGAGGGAGGGAGG - Intergenic
1058147893 9:101431632-101431654 CAACCACTGTGGAGGCTGCTTGG - Intronic
1058552669 9:106132204-106132226 GACCCACTGTGAAGACAGTGGGG - Intergenic
1058838766 9:108884965-108884987 CAACTACTCTGGAGGCTGAGGGG + Intronic
1059924045 9:119188512-119188534 CAAAGACTGTGGAGGCTGAGAGG + Intronic
1060183676 9:121551048-121551070 GAACTACAGAGGAGGGAGAGGGG + Intergenic
1060672852 9:125485563-125485585 GAAGCACTGTGCAGTCTGAGGGG - Intronic
1061523981 9:131142344-131142366 GACCAACTGTGAAGGAAGAGGGG - Intronic
1203452485 Un_GL000219v1:132744-132766 TAGCTACTGTGGAGGCTGAGTGG - Intergenic
1185892665 X:3835137-3835159 GCAGGGCTGTGGAGGCAGAGAGG + Intronic
1185897773 X:3873557-3873579 GCAGGGCTGTGGAGGCAGAGAGG + Intergenic
1185902892 X:3911988-3912010 GCAGGGCTGTGGAGGCAGAGAGG + Intergenic
1188083029 X:25868053-25868075 GAACCCATTTGGAAGCAGAGAGG - Intergenic
1188134402 X:26476895-26476917 CAACCATTGTGGAAGCAGTGTGG + Intergenic
1188261530 X:28030509-28030531 CAAGCACTCTGGAGGTAGAGTGG + Intergenic
1188319698 X:28721166-28721188 CAACCATTGTGGAAGCAGTGTGG - Intronic
1188394331 X:29661952-29661974 GAAGTGGTGTGGAGGCAGAGAGG - Intronic
1190393546 X:49956575-49956597 TAACCACTGTGGCTGCACAGAGG + Intronic
1192222136 X:69204480-69204502 GAAATACTGTGGGGGCACAGAGG - Intergenic
1193403177 X:81070075-81070097 CAACCATTGTGGAGTCAGCGTGG + Intergenic
1193452798 X:81691284-81691306 CAACCATTGTGGAAGCAGTGTGG + Intergenic
1195658471 X:107355801-107355823 AAGCCACTGGGGAGGCAAAGGGG + Intergenic
1196324643 X:114388872-114388894 AAACCTCTGTCGTGGCAGAGGGG - Intergenic
1197192739 X:123666406-123666428 GCCCCACTGTGGAGTCACAGGGG + Intronic
1199698808 X:150362113-150362135 GACCCGCTGTGGCGGCAGCGGGG - Intronic
1200118771 X:153780840-153780862 GGCCCACCCTGGAGGCAGAGGGG - Intronic
1200925560 Y:8651316-8651338 TAACCACTGTGGAAGAACAGTGG + Intergenic