ID: 1144670432

View in Genome Browser
Species Human (GRCh38)
Location 17:17129744-17129766
Sequence TACCCCAGGCCCCTGCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144670432_1144670439 18 Left 1144670432 17:17129744-17129766 CCAGTCTGCAGGGGCCTGGGGTA 0: 1
1: 0
2: 2
3: 25
4: 247
Right 1144670439 17:17129785-17129807 CTCCAGCATGCTCCACACCTTGG 0: 1
1: 0
2: 0
3: 25
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144670432 Original CRISPR TACCCCAGGCCCCTGCAGAC TGG (reversed) Intronic
900176188 1:1292434-1292456 TGCCCCAGGCCCCTGCTGGCGGG - Exonic
900558297 1:3290986-3291008 TCTCCCAGGCCCCTGGAGTCAGG - Intronic
900671584 1:3857854-3857876 GACCCCGGGCCCCCGCAGCCTGG + Intronic
901238369 1:7679519-7679541 CACCCCAGGCCCCTCGAGATGGG + Intronic
901441990 1:9283543-9283565 TCACACAGGCCCCTGCAGCCGGG + Intergenic
901445535 1:9305774-9305796 TATCCTCGGCCCCAGCAGACTGG - Intronic
902728365 1:18352142-18352164 TACCCCAGGCCTCAGCAGAGGGG - Intronic
903115573 1:21176437-21176459 TGCCCCCGGCCCCTGCACCCCGG - Intronic
904092973 1:27957948-27957970 TGCTTCAGGCCACTGCAGACGGG - Intronic
904192258 1:28754688-28754710 TGCCCCAGCCCCCTGAATACAGG - Intronic
905884090 1:41482431-41482453 TACCCTATGCCCCTGCAGGCTGG + Intronic
908332287 1:63082710-63082732 TACACCAAGGCCCTGGAGACTGG + Intergenic
908388686 1:63665921-63665943 TCCCCCAGTCCCTTGCAGTCTGG + Intergenic
912367946 1:109150349-109150371 TCCCCCAGACTCCTGTAGACTGG + Intronic
914095766 1:144543337-144543359 TACCCCTGGACCTTGAAGACAGG + Intergenic
914302754 1:146390632-146390654 TACCCCTGGACCTTGAAGACAGG - Intergenic
915093300 1:153441534-153441556 TGCCCCAGTCCCCTTCAGCCAGG - Intergenic
915551652 1:156638740-156638762 TTCCCCAGGGCCCAGGAGACTGG + Intergenic
915622317 1:157093095-157093117 TGCCCCAGGCCCCTGCCGGCTGG - Exonic
916983572 1:170166491-170166513 TCTCCCAGGCCCCTGCAGAAAGG - Exonic
918984952 1:191613559-191613581 TACCACAAGCACCTGCAGGCGGG + Intergenic
919395973 1:197047983-197048005 TCCCCCAGACCCCCACAGACAGG - Intronic
922214246 1:223507942-223507964 TACCCAAGGCCCCTGGTGGCTGG - Intergenic
922466667 1:225849317-225849339 TAGCCCAGGGCACTGGAGACTGG - Intronic
922502522 1:226107939-226107961 TACCCCAAGAGCCTGCTGACTGG + Intergenic
1063108827 10:3017566-3017588 AAGCCCTGGCCCCTGCAGCCTGG + Intergenic
1063960146 10:11300043-11300065 TTCCCCAGTCCCGTGAAGACGGG - Intronic
1066985902 10:42466340-42466362 TTCACCAGGAACCTGCAGACAGG + Intergenic
1069807111 10:71132883-71132905 TACCACACTCCCCAGCAGACAGG - Intergenic
1074516420 10:114174317-114174339 CAGCCCAGCCCACTGCAGACAGG - Intergenic
1076833588 10:133008939-133008961 TGCACCAGGCCCCTGCAGATGGG + Intergenic
1083588188 11:63875614-63875636 TGTCCTGGGCCCCTGCAGACAGG - Intronic
1083708071 11:64530255-64530277 GACCCCAGGGCACTGCAGACTGG - Intergenic
1084147873 11:67274667-67274689 TGCCCTTGGCACCTGCAGACAGG - Intronic
1084420580 11:69058593-69058615 TGCCCCAGGGCCCTGCTGGCAGG + Intronic
1084426422 11:69086778-69086800 TCCCCAAGGCCCCAGCAGCCAGG - Intronic
1084500369 11:69531482-69531504 TGCCCCAGGCAGGTGCAGACAGG - Intergenic
1084517643 11:69645159-69645181 CACCCCAGACCCATCCAGACTGG - Intronic
1084935859 11:72586327-72586349 ACCCCCATGACCCTGCAGACTGG + Intronic
1085051955 11:73384539-73384561 TACCACAGCCCTCTGCAGGCAGG + Intronic
1085197480 11:74681341-74681363 TGCCCCAGGTCCCTCCACACGGG - Intergenic
1089182066 11:116590034-116590056 TCCCTCAAGCCCCTGCAGTCTGG + Intergenic
1089691351 11:120188707-120188729 CACCCCACGCCCCTACACACAGG + Intergenic
1090351795 11:126112667-126112689 GACCCCAGGGCCCAGCAAACAGG + Intergenic
1091107253 11:132934280-132934302 TACCCCAGGCCCTGGGTGACTGG - Intronic
1092857522 12:12688748-12688770 TACCCCTGGCCCCTGCTGTGGGG - Intronic
1096758513 12:53819878-53819900 AACCCCAGGGACCTGTAGACTGG - Intergenic
1097185287 12:57193359-57193381 TCCCCCAGGCCCCTGCAGGATGG + Intronic
1097416526 12:59322957-59322979 TCCCCCATCCCCCTGCAGACTGG + Intergenic
1099987848 12:89688723-89688745 TACCCCAAGACCCTGCAGTAAGG - Intronic
1102006349 12:109591365-109591387 TAACCCCGGTTCCTGCAGACAGG - Intronic
1103355602 12:120317499-120317521 GACCCCAGGAAGCTGCAGACAGG + Intergenic
1104025222 12:125021074-125021096 CACACCTGTCCCCTGCAGACTGG - Intronic
1104442850 12:128808942-128808964 CACCCCAGCTCCCTGCAGCCTGG - Exonic
1104637748 12:130448593-130448615 TACCCCTGGCTCCTTCAGTCCGG - Intronic
1108394352 13:49978491-49978513 TCCCCCACGCCCCTGAAGCCAGG - Intergenic
1110466543 13:75808104-75808126 CACCCCTGGCCCCTGCAGTGAGG + Exonic
1110533852 13:76628473-76628495 CACCCCTGGCCCCAGCTGACAGG - Intergenic
1112136765 13:96587465-96587487 TACCTCATGCTTCTGCAGACAGG + Intronic
1113854199 13:113435044-113435066 TACCCCAGGACCCGGCACCCAGG + Intronic
1113854814 13:113437354-113437376 TACCCCAGGACCCAGCACCCAGG + Intronic
1114259488 14:21026337-21026359 CACCCCAACCCCCTTCAGACTGG + Intronic
1114672766 14:24420624-24420646 GACCCCAGGCCCCTGCACCATGG - Intergenic
1115149212 14:30264707-30264729 TGCCCCAGGTCTCTGCTGACTGG - Intergenic
1118316590 14:64729675-64729697 TATCCCAGGCCCCTTAAGATGGG + Intronic
1118514269 14:66508775-66508797 TCCCCCAGGCCCCAGGAGCCGGG + Intronic
1120873676 14:89360117-89360139 TCCCCGGGGCCCCTGCACACTGG + Intronic
1121271622 14:92641622-92641644 TACCCCAGGGCCCTTCTGAGTGG + Intronic
1121737120 14:96226251-96226273 TACCCCAGGCCGAGGCAGAGGGG - Intronic
1122098174 14:99386623-99386645 TACCCCCGGCCCCTGAAGGGAGG + Intergenic
1122586063 14:102807341-102807363 GGCCCCAGGCCCCTGGAGAAAGG - Intronic
1122683928 14:103489349-103489371 ATCCCCAGGCCCCTGAAGTCTGG - Intronic
1124514802 15:30357555-30357577 ACCCCCAAGACCCTGCAGACAGG + Intergenic
1124728119 15:32173207-32173229 ACCCCCAAGACCCTGCAGACAGG - Intergenic
1127364512 15:58275102-58275124 AACCCCAGGACACTGCAGTCCGG + Intronic
1127835737 15:62789478-62789500 TACCCCAGTGCCCTGCTGCCCGG - Intronic
1128078668 15:64843385-64843407 TGCCCCAGGCCCCTGCTGCAAGG + Intronic
1128240400 15:66097361-66097383 AACCCCAGGCCTCTGGAGATGGG - Intronic
1128353713 15:66909527-66909549 CCACCCAGGCTCCTGCAGACTGG + Intergenic
1128698663 15:69788140-69788162 GACCCAAGGCCCCTGAAGAATGG - Intergenic
1129188959 15:73926756-73926778 TCCACCAGGCCTCTGCAGAGGGG + Exonic
1129614472 15:77087410-77087432 AGCCCCAGGCCCCTGCACAGGGG + Intergenic
1130466926 15:84197105-84197127 TGCCCCAGCCCCCTGCACCCAGG - Intergenic
1130497338 15:84476431-84476453 TGCCCCAGCCCCCTGCACCCAGG + Intergenic
1130557355 15:84932031-84932053 CACCCCTGGCCCCAGCAGCCAGG + Intronic
1132933549 16:2470390-2470412 TACTCCCTGCCCCTGCAGAGGGG + Intergenic
1136470190 16:30474420-30474442 CACCACAGGCTCCTCCAGACGGG - Intronic
1136993849 16:35174117-35174139 CACTCCAGGCACCTGCAGAGTGG + Intergenic
1139311221 16:66029886-66029908 TCCCCCAGGGCCCAGCAGAGTGG - Intergenic
1142001193 16:87665324-87665346 TACCCCAAGACCCTGCACAATGG - Intronic
1142059045 16:88018063-88018085 TGCCCCAGCCACCTGCAGAGCGG - Intronic
1142176527 16:88647883-88647905 CAGCCCAGGCCCCAGCAGCCAGG - Intronic
1142351533 16:89582993-89583015 AGGCCCAGGCCCCTGCAGCCAGG - Intronic
1143260372 17:5594093-5594115 TGCCCTAAGCCCCTGCAGACTGG - Intronic
1143367167 17:6415797-6415819 TCCCCCAGACCCATGTAGACTGG - Intronic
1143611273 17:8019264-8019286 TACTCCAGGCCCTTGCAGGCAGG - Intronic
1144670432 17:17129744-17129766 TACCCCAGGCCCCTGCAGACTGG - Intronic
1144767532 17:17740706-17740728 TCCCCCAGGCTCCTGCTGCCTGG - Intronic
1145061985 17:19739299-19739321 TTGCCCAGGGCCCTGCACACAGG - Intronic
1145775326 17:27524032-27524054 TACCTCTGGCCCATGCAGGCTGG + Intronic
1145817195 17:27804191-27804213 CAGCCCTGGACCCTGCAGACAGG - Exonic
1145888503 17:28398698-28398720 TTCCCCAGGCCCATGAAGAGAGG + Exonic
1146571657 17:33958245-33958267 GACCCCAGACCCCTCCAGAATGG - Intronic
1146716126 17:35088802-35088824 TCCCCAAGCGCCCTGCAGACCGG - Intronic
1147543351 17:41379510-41379532 TGCCCCAGGGCCCTGGAGACAGG - Intronic
1147951620 17:44110953-44110975 TCCCTCAGGCCACTGCCGACGGG + Intronic
1147992723 17:44345007-44345029 TCCCCCAGGCGCCTGCAGGATGG + Intergenic
1148153161 17:45408446-45408468 TCCCCCAGGCGCCTGGGGACTGG - Intronic
1148191372 17:45681087-45681109 TGCCCCAGGCCCCGGGAGAGGGG - Intergenic
1148349650 17:46931237-46931259 TACTCCAGGCCCATCAAGACAGG + Intronic
1148744992 17:49913082-49913104 GGCCCCAGGCCCCAGCTGACGGG + Intergenic
1149006492 17:51811433-51811455 TACTCCAGCCCCCTCCCGACAGG + Intronic
1149534231 17:57420092-57420114 TACCCCAGGACCCAGCAGATGGG - Intronic
1152252691 17:79220033-79220055 TCCCCCAGGGCCCAGCAGGCAGG - Intronic
1152550449 17:81027309-81027331 TCCCGCAGGTCCCTGCAGACAGG - Intergenic
1152727799 17:81956272-81956294 TAGCCCAGGACCCTGCAGCAGGG + Intronic
1152918646 17:83054580-83054602 TACTCCAGGCCCCTGGCAACTGG - Intergenic
1153223344 18:2880503-2880525 TACCCAAGGCACCTGTGGACGGG + Intronic
1156454580 18:37285730-37285752 TGTCCCAGGCTCCTGCAGAAAGG - Intronic
1157491279 18:48125544-48125566 TTCCCCAGACCACAGCAGACAGG + Intronic
1157559652 18:48637389-48637411 TCCCACAGGCTCCTGCAGGCAGG - Intronic
1158471153 18:57738186-57738208 CACTCCAGGACACTGCAGACAGG + Intronic
1160402361 18:78620306-78620328 TTCCCCATGCTCCAGCAGACTGG - Intergenic
1160445973 18:78927097-78927119 CACCCCAGGCCTCTGCAGACAGG - Intergenic
1160691486 19:462279-462301 CACCCCAGGACCCAGCAGCCTGG - Intergenic
1160836023 19:1124778-1124800 GACCCCAGGCCTTGGCAGACAGG + Intronic
1161352464 19:3801623-3801645 TTCTCCAGCCCCCTGCAGCCTGG + Exonic
1162787292 19:13043678-13043700 TCCCCCAGGGCCATGCAGGCAGG + Intronic
1163270824 19:16252516-16252538 GACCCCAAGTCCCTGGAGACGGG + Intergenic
1164041951 19:21500693-21500715 TTCCCCAGGCCTCTACAAACAGG - Intronic
1164311610 19:24051020-24051042 TATGCCAGGGCCCTGCCGACTGG + Intronic
1164934355 19:32199680-32199702 TGCCCGGGGCCCCTGCAGCCAGG - Intergenic
1166111490 19:40625954-40625976 TGCCCCAGGCCTCTCCATACAGG - Exonic
1166530547 19:43540628-43540650 TCTCCCAGGTCCCTGCAGAGGGG + Intergenic
1166679161 19:44756830-44756852 TTCCCCAGGACCCAGAAGACTGG - Intronic
1167606306 19:50482579-50482601 TACCCCGAGCCCATGCAGTCTGG + Exonic
1168178431 19:54643053-54643075 AACCCCAGGCCCTCACAGACAGG - Intronic
1168181582 19:54665599-54665621 TGCCCCAGACCCCTCCAGCCAGG - Intronic
925184497 2:1837706-1837728 TCACCCAGGGCCCAGCAGACAGG - Intronic
925333662 2:3077586-3077608 CCCCCCAGGTCCCTGCACACAGG + Intergenic
925414877 2:3662432-3662454 TACGCCAAGGCCCTGCAGGCAGG + Intronic
925611983 2:5709268-5709290 TACTACAAGCCCCTGGAGACAGG - Intergenic
925720369 2:6821224-6821246 TTCCCCATGCCCCTCCAGAGAGG + Intergenic
925951994 2:8923475-8923497 TTCTCCAGGCCCCTGCCAACCGG + Intronic
928438127 2:31269106-31269128 TCTCCCAGGCCCCTGAAGCCTGG - Exonic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
932708580 2:74046411-74046433 ACCCCCAGTCCCCAGCAGACTGG - Exonic
933694361 2:85206111-85206133 TGGCCCTAGCCCCTGCAGACAGG - Intronic
933790317 2:85878995-85879017 TTCCCCAGGCCCCTGTAATCTGG - Intronic
936141471 2:109945717-109945739 TTCCCCAGGGCCTTGCAGAAAGG - Intergenic
936178160 2:110243665-110243687 TTCCCCAGGGCCTTGCAGAAAGG - Intergenic
936203222 2:110425766-110425788 TTCCCCAGGGCCTTGCAGAAAGG + Intronic
936462221 2:112722172-112722194 AACACCAGCCGCCTGCAGACGGG - Exonic
937077432 2:119117442-119117464 TCCCTCAGGCACCTGCAGGCTGG + Intergenic
937292654 2:120790869-120790891 CCCCCCAGGGCCCTGCAGGCAGG + Intronic
937887621 2:126910891-126910913 AACACCAGGCCCCTTCTGACTGG + Intergenic
937915760 2:127097958-127097980 TCCCTCAGGCCCCAGCAGTCAGG - Intronic
940190854 2:151038664-151038686 TCACCCTGGCCCCTGCAGGCTGG + Intronic
940878668 2:158923556-158923578 TCCCCCAGTCGCCTGCAGAGAGG - Intergenic
947620892 2:231590411-231590433 TGCACCAGGCCCCAGCAGACTGG - Intergenic
947743727 2:232496998-232497020 TGCCCCAGGCGCCTGCTGCCAGG - Intergenic
948749647 2:240124313-240124335 TCCCCCAGGCCCCTCCAGAGTGG + Intergenic
1168736889 20:148185-148207 TTCCCCAGGGCCCTGCCCACTGG + Intergenic
1169638350 20:7720334-7720356 TACCTTAGGCCTCTGCTGACTGG - Intergenic
1171279486 20:23883776-23883798 TGGGCCAGGCCCCTGCAGGCTGG - Intergenic
1174755330 20:53152915-53152937 TACCCCAGTCCTGTGCAGGCAGG + Intronic
1175722989 20:61298539-61298561 TACCTGCAGCCCCTGCAGACGGG - Intronic
1175905998 20:62379741-62379763 GACCCCAGGCCCCAGCATTCCGG - Intergenic
1176119533 20:63447970-63447992 CACCCCAGGAAGCTGCAGACAGG + Intronic
1176215485 20:63945781-63945803 TAGGCCAGGGCCCTGCAGAGGGG - Intronic
1179513510 21:41891087-41891109 TCCCCGAAGCCCCTGCACACAGG - Intronic
1179526899 21:41984847-41984869 TATCCCAGTCTCCTGCAGTCTGG - Intergenic
1179631955 21:42684263-42684285 CACCCCTGCCCTCTGCAGACTGG + Intronic
1180082267 21:45492392-45492414 TGCCCCAGGCCCAGGAAGACTGG + Intronic
1180593480 22:16959449-16959471 TACACCAGGCCCCTGAGGCCTGG - Intergenic
1181275160 22:21683475-21683497 TTCCCCTGCTCCCTGCAGACTGG + Intronic
1184279222 22:43427507-43427529 CACCACAGGCCCCTGCAGGCCGG + Intronic
1184343722 22:43900498-43900520 TAACCCAGGGCCCAGCAGCCAGG + Intergenic
1184533780 22:45072682-45072704 ATCCCCAGGCCTCTGCACACAGG + Intergenic
1184982395 22:48103743-48103765 GACCCCAGCCCCCTACAGAGGGG - Intergenic
1185226413 22:49656340-49656362 ACCCCCAGGCCCCTGCGGCCTGG + Intronic
949870620 3:8584891-8584913 TTCCCCTGTCCCCTGCAGCCAGG + Intergenic
952206020 3:31181932-31181954 TCCTCCATGTCCCTGCAGACGGG - Intergenic
953133864 3:40166419-40166441 TACCCCCGGCCCCTTCCCACAGG - Intronic
954296002 3:49674754-49674776 TCCCACAGGTCCCTGCACACAGG + Intronic
954400111 3:50315052-50315074 CACCCCAGGGCCCTGCCCACAGG + Intergenic
954800781 3:53185854-53185876 TACCCCAGGCCCCGGGGGAGGGG + Intronic
960013544 3:112859734-112859756 TAACCCAGGCCTTTGTAGACAGG + Intergenic
960396339 3:117141997-117142019 TTCCCCAGGCCCCTGCATATAGG - Intergenic
961319539 3:126063322-126063344 TACCCAAGGCCCCTTGAGATGGG + Intronic
961732097 3:128973300-128973322 TAAACCATGCCCGTGCAGACCGG + Intronic
961822236 3:129580951-129580973 TCCCTCAGGCACCTGCAAACGGG + Intronic
964384825 3:156136452-156136474 TAAGCCAGGCCAGTGCAGACTGG + Intronic
964670997 3:159226209-159226231 CACCCCAGACCTCTGGAGACGGG - Intronic
967883972 3:194320972-194320994 GACCCCAGTCCCTTGGAGACGGG - Intergenic
967887745 3:194344896-194344918 TACCCCATGCCTCTTCAGCCAGG - Intronic
968869641 4:3235126-3235148 TCCCCCAGGCCCCTGCAACCTGG - Intronic
968935034 4:3605392-3605414 TACCCCAAGCCTGTGCAGCCAGG + Intergenic
969292882 4:6252041-6252063 TAGCCCAGGTCCCTGTAGCCCGG + Intergenic
969489808 4:7492673-7492695 TTCCCCAGCCCCTTGGAGACTGG + Intronic
970193648 4:13536554-13536576 ATTCCCAGGCCCCTGCAGGCAGG - Intergenic
970353179 4:15226710-15226732 GCCCCCCTGCCCCTGCAGACTGG - Intergenic
970864966 4:20747751-20747773 TACTCCATGCTCATGCAGACTGG - Intronic
972072371 4:35038215-35038237 TACCCCAGGCCCCAACAGTGCGG - Intergenic
974365682 4:60945991-60946013 TATCCCAGGCCCATGCACTCTGG + Intergenic
977243524 4:94602745-94602767 CACACCAGGCCCCTGCAGCCTGG + Intronic
989247454 5:39269805-39269827 TTCCCCAGCCCCCAGAAGACTGG - Intronic
990237229 5:53781343-53781365 GACCCCAGGCCCCTGCCTCCAGG + Intergenic
990954545 5:61330405-61330427 GACCCCAGGGACCTGCAGCCTGG + Intergenic
996265831 5:121538758-121538780 AACCCCAAGCCCCTGCACAAAGG + Intergenic
997467015 5:134094883-134094905 TTCCCCAGGCCTTTGCAGTCTGG - Intergenic
997675296 5:135708103-135708125 TATCCCAGGCCCCTGCTGCCTGG - Intergenic
997986752 5:138507687-138507709 TACCCCGTCCCCCTCCAGACTGG - Exonic
999171521 5:149599259-149599281 GCCCCCAGGCCCCCGAAGACAGG + Intronic
999318978 5:150601604-150601626 TACCCCACCGACCTGCAGACAGG - Intronic
999730982 5:154476615-154476637 TACCACAGGCCCCCGCAGGTTGG + Intronic
999743231 5:154572965-154572987 ACCCCCAGGCCCCTGGAGAGGGG - Intergenic
1002073858 5:176696631-176696653 TTCCCCAGGCCCCTCCAGGTTGG - Intergenic
1002424310 5:179166520-179166542 TTACCCAGACCCCTGCAGGCTGG - Intronic
1002439568 5:179257340-179257362 TCCTCCAGGCCCCCGCAGCCTGG - Intronic
1002857533 6:1051469-1051491 TGCCCCAGGACTCTGCAGAGAGG - Intergenic
1004689875 6:17984047-17984069 TACCTCATGCTCCTGCATACTGG - Intronic
1005878383 6:30033594-30033616 TACCCCTTCCCCCTCCAGACTGG + Intergenic
1008560566 6:52720707-52720729 TACCCCAAGCCCCTGGAGCTTGG - Intergenic
1010514684 6:76759309-76759331 TACCCCAGCCCACTACAGATGGG + Intergenic
1012872610 6:104689865-104689887 TTCCCCAGACCCCTTCAGAAAGG - Intergenic
1014445021 6:121516916-121516938 TACCACAGGCACGTGCAGCCAGG - Intergenic
1016833189 6:148453023-148453045 TACCCCAAGCTCCTGCATTCTGG - Intronic
1018153129 6:160959241-160959263 TTCCCCAGGCCCCTGCAATTAGG - Intergenic
1018977128 6:168574279-168574301 TGCTCCAGGACCCTGCAGGCCGG + Intronic
1019921066 7:4163544-4163566 TCTCCCAGGGCCCTGCAGAAGGG + Intronic
1020085425 7:5307738-5307760 GCCCCCAGGTCCATGCAGACTGG - Exonic
1020761182 7:12269675-12269697 CACGCCAGGCCCCTGCCGCCAGG + Intergenic
1020948354 7:14643992-14644014 TCCCCCAGGATCCTGAAGACTGG + Intronic
1022104954 7:27190880-27190902 TTCCCCTGGCCACTGCAGAGTGG + Intergenic
1022248520 7:28584313-28584335 AACCCCTGGCCCCTGCGGATGGG + Intronic
1022865835 7:34418907-34418929 TAACCCAGGGCCCTGCACATTGG + Intergenic
1024061223 7:45700056-45700078 TACCCCAGAGCCCTGCAGGGAGG + Intronic
1025208895 7:57009555-57009577 GCCCCCAGGCCCATGCAGACTGG + Intergenic
1025663056 7:63567301-63567323 GCCCCCAGGCCCATGCAGACTGG - Intergenic
1026930149 7:74219423-74219445 GGTCCCAGGCCCCTGGAGACGGG - Intronic
1029528962 7:101112596-101112618 CACCGCAGGCCCCTGCAGAAGGG - Intergenic
1036706295 8:11049449-11049471 TCCCGCAGCCCCCTGCAGAGAGG - Intronic
1037112725 8:15184528-15184550 TACACCAGGCCTCGGGAGACTGG + Intronic
1039555620 8:38472787-38472809 TGCCCCAGGCCCCTGGAGTTAGG + Intergenic
1042212081 8:66391063-66391085 TACCCCAGGTCCTTGCAGGAAGG - Intergenic
1045328773 8:101137364-101137386 CACCCCAGGCCCGTGCCGCCTGG - Intergenic
1050555309 9:6784639-6784661 TACCCCTGGCCTCAGCAGGCAGG + Intronic
1053130098 9:35609711-35609733 TGCCCCAGGCAGCTGCAGGCTGG - Exonic
1053623016 9:39840038-39840060 TAGCTCACGCCCCTCCAGACAGG - Intergenic
1053881857 9:42603189-42603211 TAGCTCACGCCCCTCCAGACAGG + Intergenic
1054220881 9:62410654-62410676 TAGCTCACGCCCCTCCAGACAGG + Intergenic
1054229833 9:62498518-62498540 TAGCTCACGCCCCTCCAGACAGG - Intergenic
1054455141 9:65426586-65426608 TACCCCAAGCCTGTGCAGCCAGG - Intergenic
1056096271 9:83257364-83257386 TCCCCCAACCCCCTGCCGACAGG - Intronic
1056568822 9:87798353-87798375 TACCCAAGGCCCCTGCGGGAGGG - Intergenic
1056674904 9:88667143-88667165 TACCCCACGCCCCCTCTGACAGG + Intergenic
1057951691 9:99373949-99373971 GACCCCAGGCCCCTGCATACTGG - Intergenic
1059426717 9:114225803-114225825 TCCCCCGGGTCCCTGCAGCCGGG + Intronic
1060431191 9:123552558-123552580 TACCCCAGGACCCTGCATGGTGG + Intronic
1060483237 9:124030231-124030253 GGCCACAGGCCCCTGCAGCCGGG + Intronic
1060597880 9:124858892-124858914 GGCCCCAGGCCCCTGCAGGTGGG + Intronic
1061391243 9:130318367-130318389 TGTCCCAGGCCCCTGCAGCAGGG - Intronic
1061490841 9:130943398-130943420 TCCCCCAGGCCCCGAGAGACTGG - Intergenic
1062109624 9:134774801-134774823 TTCCCCAGGCACCTCCACACTGG + Intronic
1062218126 9:135400016-135400038 GGCCCCAGGTGCCTGCAGACAGG + Intergenic
1062364195 9:136201262-136201284 TACCCCGGAGGCCTGCAGACAGG - Intronic
1062433556 9:136536214-136536236 TCCCCCAGCTGCCTGCAGACAGG + Intronic
1062590483 9:137272412-137272434 TGGCCAAGGCCCCTGGAGACAGG - Intronic
1190320942 X:49178862-49178884 TACCACTGGGCCCTGCAGACAGG + Intronic
1190804422 X:53821450-53821472 CTCCCCAGGCCCTTGCAGTCTGG + Intergenic
1192035980 X:67563569-67563591 TTCCCCAGGCCACTGCTGCCTGG + Intronic
1193289596 X:79755949-79755971 TTCCCTAGGCTCCTGTAGACTGG + Intergenic
1198873657 X:141201228-141201250 TACCTGAGGCCTCTTCAGACTGG - Intergenic
1200116706 X:153772720-153772742 TTCCCGAGGCCACTGCACACTGG - Intronic