ID: 1144670476

View in Genome Browser
Species Human (GRCh38)
Location 17:17129986-17130008
Sequence AAGTGTGACCAGGGAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 1, 2: 3, 3: 52, 4: 467}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144670470_1144670476 -9 Left 1144670470 17:17129972-17129994 CCAGCCTTGATGAGAAGTGTGAC 0: 1
1: 0
2: 0
3: 24
4: 502
Right 1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG 0: 1
1: 1
2: 3
3: 52
4: 467
1144670466_1144670476 11 Left 1144670466 17:17129952-17129974 CCTGGGACCTCTGCTCCCAGCCA 0: 1
1: 0
2: 7
3: 58
4: 511
Right 1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG 0: 1
1: 1
2: 3
3: 52
4: 467
1144670468_1144670476 -4 Left 1144670468 17:17129967-17129989 CCCAGCCAGCCTTGATGAGAAGT 0: 1
1: 1
2: 1
3: 6
4: 127
Right 1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG 0: 1
1: 1
2: 3
3: 52
4: 467
1144670464_1144670476 17 Left 1144670464 17:17129946-17129968 CCCTCTCCTGGGACCTCTGCTCC 0: 1
1: 0
2: 4
3: 87
4: 626
Right 1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG 0: 1
1: 1
2: 3
3: 52
4: 467
1144670467_1144670476 4 Left 1144670467 17:17129959-17129981 CCTCTGCTCCCAGCCAGCCTTGA 0: 1
1: 2
2: 15
3: 255
4: 1693
Right 1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG 0: 1
1: 1
2: 3
3: 52
4: 467
1144670469_1144670476 -5 Left 1144670469 17:17129968-17129990 CCAGCCAGCCTTGATGAGAAGTG 0: 1
1: 1
2: 0
3: 17
4: 186
Right 1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG 0: 1
1: 1
2: 3
3: 52
4: 467
1144670465_1144670476 16 Left 1144670465 17:17129947-17129969 CCTCTCCTGGGACCTCTGCTCCC 0: 1
1: 0
2: 4
3: 81
4: 652
Right 1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG 0: 1
1: 1
2: 3
3: 52
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144670476 Original CRISPR AAGTGTGACCAGGGAGGAGA GGG Intronic
900895697 1:5481494-5481516 AGCTGTGGCCAGGGAGGGGAGGG - Intergenic
901175996 1:7299623-7299645 GAATGTGGCCAGGGAGGAGATGG - Intronic
901380095 1:8867340-8867362 AGGTGTGATGGGGGAGGAGATGG - Intronic
902367109 1:15983212-15983234 GAGTCTGACCAAGGAGGATATGG + Intergenic
902408181 1:16197949-16197971 AAGGGTGACCAGGGGGCAGGGGG - Intronic
902440709 1:16428083-16428105 AAGAGTACCCAGGGAGGAGTGGG - Intronic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
903776509 1:25797538-25797560 AAGTGTGAAGAGGGAGGAGGAGG - Intergenic
904306561 1:29593914-29593936 AAGGGGGAAGAGGGAGGAGAAGG + Intergenic
904745192 1:32706408-32706430 TGGTGTGCCCAGGGAGGGGATGG - Intergenic
905282690 1:36859322-36859344 ACCTGTGGCAAGGGAGGAGAAGG - Intronic
905453540 1:38072468-38072490 TAGTCACACCAGGGAGGAGAAGG + Intergenic
905502646 1:38451870-38451892 GAGGATGACTAGGGAGGAGAGGG - Intergenic
905880097 1:41457641-41457663 AACTAGGCCCAGGGAGGAGAGGG + Intergenic
906926300 1:50120871-50120893 ATGTGTGGCCAGAGAGAAGATGG + Intronic
907313322 1:53552261-53552283 AAGTGTGTCCCGGTAGGAGGGGG + Intronic
907426729 1:54384418-54384440 AAGAGTGATCAGGGAGGATCAGG - Intronic
909070478 1:70987205-70987227 AAAGGTGACCAGGAAGGAAATGG + Intronic
909213008 1:72848119-72848141 AAGTGTTACTAGAGAGGAGAGGG + Intergenic
909380334 1:74990610-74990632 CAGTGCGATCAGGCAGGAGAAGG + Intergenic
910718477 1:90258243-90258265 AAGTGTAACCAGGGAGGCTCTGG + Intergenic
911162371 1:94694108-94694130 TAGAGTGAACAAGGAGGAGAGGG + Intergenic
912249248 1:107993699-107993721 AGGTGTGAGCAGGGATGAGTTGG - Intergenic
913232138 1:116748842-116748864 AAGAGTGGCAAGGGAGGAGCTGG + Intergenic
915514124 1:156402713-156402735 AACTGAGGCCAGAGAGGAGAAGG - Intergenic
915580368 1:156809501-156809523 AGGTGAGGCCAGGGAGGAGTGGG + Intronic
916698839 1:167269535-167269557 GAGAGTGACAAAGGAGGAGAAGG + Intronic
917276258 1:173334905-173334927 AAGTGTGACCCAAGAGGAGGTGG + Intergenic
918125546 1:181580440-181580462 CAGAGAGGCCAGGGAGGAGAGGG + Intronic
919053405 1:192539280-192539302 AAGTAGAACCAGGGAGGAGGGGG + Intergenic
920262689 1:204700160-204700182 AACTATGACCAGCCAGGAGAGGG - Intergenic
920349490 1:205328541-205328563 AAGTGTGCCCAGGAGGGAGGTGG + Intergenic
921170027 1:212538804-212538826 AACTGTGACCTGGGAGGCGGAGG + Intergenic
921173125 1:212566564-212566586 AACTGTGACCAGGGCATAGAGGG + Intronic
921571200 1:216780715-216780737 AACAGAGTCCAGGGAGGAGAAGG + Intronic
921704953 1:218311972-218311994 CAGTGTGACCATGGAGGAATAGG + Intronic
921860608 1:220038766-220038788 AAGTGGGCGCAGGGAGGTGAGGG + Intronic
922241290 1:223756925-223756947 AACTGAGGCCAGAGAGGAGAGGG + Intronic
922724990 1:227918465-227918487 AGGAGGGACCAGGGAGGAGGAGG - Intergenic
923324210 1:232866489-232866511 AAGGCTGACCAGGATGGAGAGGG - Intergenic
923495326 1:234519625-234519647 AAGTGTGACAAGGCAGGCGAGGG + Intergenic
923575713 1:235157219-235157241 AAGGGAGACCAGTAAGGAGATGG + Intronic
923761297 1:236847486-236847508 GACTGTGACCAGTGAGTAGAAGG - Intronic
924096839 1:240560804-240560826 ATTTGGGATCAGGGAGGAGAAGG - Intronic
924732912 1:246728493-246728515 AAGTGTGACCAGTTAGCAGGGGG - Intronic
1063695060 10:8326706-8326728 AAGTGGGAGCCGGGAGGGGAGGG + Intergenic
1064428428 10:15250953-15250975 AAAGGTGACAAGGGAGGAGAAGG - Intronic
1065127976 10:22592646-22592668 AAGAGTCACATGGGAGGAGAAGG - Intronic
1065348971 10:24778457-24778479 AAGCCTGACCAAGGAGGCGAAGG + Intergenic
1065708752 10:28495283-28495305 AAGGGAGAGGAGGGAGGAGAAGG + Intergenic
1065750103 10:28878178-28878200 AAGTGGAATCAAGGAGGAGAAGG - Intronic
1067247648 10:44559719-44559741 AAGAGTGGCCCAGGAGGAGAAGG - Intergenic
1067451636 10:46385327-46385349 GAGGGAGACCAGGGAGGTGAGGG - Intronic
1067566181 10:47339604-47339626 AAGTGTGGCCAGGCAGCAGGAGG - Intergenic
1067585603 10:47474429-47474451 GAGGGAGACCAGGGAGGTGAGGG + Intronic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1068931174 10:62592225-62592247 AAGTGTGAGAAAGCAGGAGAAGG - Intronic
1069599207 10:69692645-69692667 AAGGGTGATGAGGGAGGATAAGG + Intergenic
1069599434 10:69693918-69693940 AAGGGTGATGAGGGAGGATAAGG - Intergenic
1070718426 10:78739526-78739548 ACCTGAGACCAGGGAGGAGCAGG - Intergenic
1070726314 10:78793656-78793678 GCGTGTGATCAGGGTGGAGAGGG - Intergenic
1071511464 10:86264995-86265017 AAGTGTGGCTAGGAAGGAAAAGG - Intronic
1071602051 10:86963099-86963121 AAGGGTGGCCAGGGAGACGAGGG - Exonic
1071986516 10:91056674-91056696 AAGTGTGACCAGGGTGATAATGG - Intergenic
1072004676 10:91233056-91233078 AAGTATGACCAAAGAAGAGAGGG + Intronic
1072292503 10:93977125-93977147 AAGAGTGAGCAGCCAGGAGAAGG - Intergenic
1073192754 10:101663354-101663376 AAGGGTGAGAAGGGAAGAGATGG + Intronic
1073205101 10:101764898-101764920 AAGTGTGTCCAGGGAGCAGCAGG + Intergenic
1073451857 10:103614689-103614711 AGATGTGTCCAGGGAGCAGATGG - Intronic
1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG + Intronic
1074537954 10:114342279-114342301 AGGTATGAGCAGGGAGGAGAGGG - Intronic
1074775571 10:116766106-116766128 AAGGTGGACAAGGGAGGAGAGGG - Intergenic
1074949473 10:118316386-118316408 AGGTGTGACCATGGAGGGAAAGG - Intronic
1074964916 10:118482109-118482131 CAGTGTGACCTGGGAGGAAATGG - Intergenic
1075299339 10:121307421-121307443 AAGTGGTCCCAGGGAGCAGAAGG - Intergenic
1075928740 10:126274818-126274840 AAATGTAACCAGTGTGGAGATGG - Intronic
1076697242 10:132252873-132252895 CAGAGTGACCTGGGAGGAGGCGG - Intronic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1077248502 11:1550537-1550559 ATGTGTGGCTAGGGAGTAGAAGG - Intergenic
1077498445 11:2897923-2897945 AAGGGTGACCTGGAAGGAGCGGG - Intronic
1077967071 11:7146265-7146287 AATCGTGACTAAGGAGGAGAAGG + Intergenic
1078102834 11:8339839-8339861 AGGCGTGGTCAGGGAGGAGATGG - Intergenic
1078657863 11:13259092-13259114 AGGTGTGACCAGGCAGGAGAAGG + Intergenic
1078664422 11:13312965-13312987 CAGTGAGACCGGGGTGGAGAGGG + Intronic
1079332302 11:19543756-19543778 AAGTGAGACAAGAGAGGACAAGG - Intronic
1079420576 11:20283430-20283452 AAGTTGGACCAGGGAGGATAGGG + Intergenic
1080054118 11:27887473-27887495 AAGTGTGACCTGGAAGGGGGTGG + Intergenic
1081065932 11:38538918-38538940 AAATTTGAGCAGGGAGCAGAGGG - Intergenic
1081391923 11:42539597-42539619 AAGTGGGACAGGGAAGGAGAAGG + Intergenic
1081972266 11:47207685-47207707 AGGTTGGACCAGGGTGGAGAAGG - Intergenic
1083161884 11:60859360-60859382 AAGAGTTACCAGGGAAGACAGGG - Intergenic
1083722225 11:64609043-64609065 AAGAGTGGGCAGGGAGGAGTTGG + Intronic
1083952523 11:65964946-65964968 AAGTGGGAGCAGGGAGGTGAAGG + Intronic
1084518298 11:69648131-69648153 AAGTGTGACCCGGTAAGTGAGGG + Exonic
1084614229 11:70225114-70225136 AATTGTGAACAGGAAGGAGAGGG + Intergenic
1087203855 11:95373400-95373422 ATGTGTCAGCAGGGAGGAGAGGG + Intergenic
1087434931 11:98102631-98102653 AATGGTGACCAGGGGCGAGAAGG + Intergenic
1088438956 11:109846994-109847016 ATGTTTGACCAGTGAGAAGAAGG - Intergenic
1089135974 11:116249564-116249586 AAGTGAGCCCAGGCAGGAAAGGG + Intergenic
1090451575 11:126810955-126810977 GAGTGTGTGCAGGGAGGAGGTGG + Intronic
1091330013 11:134724938-134724960 AAGTGTGGCCCGAGCGGAGACGG + Intergenic
1091690436 12:2592867-2592889 AAAGGTGACCAGGTAGGACAGGG - Intronic
1091761570 12:3090847-3090869 AACAGTGATCTGGGAGGAGAAGG - Intronic
1092322363 12:7490048-7490070 AACTGTGTTCATGGAGGAGAAGG - Intronic
1092787303 12:12038726-12038748 AATTTTGGACAGGGAGGAGAGGG + Intergenic
1093417446 12:18935819-18935841 ATGTGTGAGCATGGAGGATATGG - Intergenic
1093978184 12:25446784-25446806 AAATGTCACCAGAGAGGAAAAGG + Intronic
1094299491 12:28946318-28946340 AAGTGTGACCCTGGAGCAGAGGG - Intergenic
1095905303 12:47371185-47371207 TAGGTTGACCAGGTAGGAGAAGG - Intergenic
1096219138 12:49817087-49817109 AAGTTTAACCAAGGAGGTGAAGG + Intronic
1096706200 12:53423986-53424008 AAGTGTCTACAGGGAGGGGAAGG + Intronic
1096734545 12:53642360-53642382 AAGTGTGACCCAGGAGGAGGTGG + Intronic
1097244015 12:57596060-57596082 ATATGTGAGTAGGGAGGAGAGGG - Intronic
1099328587 12:81251999-81252021 AAGAGTGAGAATGGAGGAGATGG - Intronic
1099927960 12:89040961-89040983 AGATTTGACCATGGAGGAGATGG + Intergenic
1099940521 12:89182709-89182731 GAGAGTGACCAGGTTGGAGAAGG - Intergenic
1100193491 12:92218185-92218207 AAGTGAGAACAGAGTGGAGAAGG + Intergenic
1100355684 12:93827009-93827031 AAGTGGGGCCAGGGACAAGAAGG + Intronic
1101248738 12:102910842-102910864 AGGTAAGACCAGGGAGGGGAAGG - Intronic
1101991620 12:109490149-109490171 AAGTGAGACAAGGCAGGGGAAGG - Intronic
1102039614 12:109792496-109792518 GGGTGGGACCAGGGTGGAGATGG - Intronic
1102043982 12:109818199-109818221 TAGATTGACCAGGGAGGAGAGGG + Intronic
1102858504 12:116315366-116315388 AAGAGAGACCAAGGAAGAGACGG - Intergenic
1104904977 12:132208293-132208315 TAGTGTGGCCAGGAAGGGGAGGG - Intronic
1105256154 13:18745077-18745099 AAGCGGGACCTGGGAGAAGAGGG + Intergenic
1105599347 13:21872055-21872077 AGGTGAGTCCAGGCAGGAGAGGG + Intergenic
1105665484 13:22551633-22551655 AAGTGGGACCAGGGAGCCAACGG + Intergenic
1105683421 13:22752571-22752593 AAGCGGGAGCGGGGAGGAGAGGG - Intergenic
1105947973 13:25205862-25205884 TAGCATGGCCAGGGAGGAGAAGG - Intergenic
1105959463 13:25317166-25317188 AAGTGAGACTAGAGATGAGAAGG + Intronic
1106041700 13:26099804-26099826 AAATGACACCAGGGAGGTGATGG + Intergenic
1109223841 13:59669246-59669268 AAGTGAGACCAGGAAAGAAATGG - Intronic
1109766267 13:66903383-66903405 AAATGTGACCACAGAAGAGATGG + Intronic
1110740575 13:78991292-78991314 AACTGAGACTAGGGAGGACAAGG - Intergenic
1111253556 13:85638396-85638418 AAGGGTGAGCAGGGTGGTGAGGG + Intergenic
1112237776 13:97651725-97651747 TAGTGTGCCCAGGGATAAGATGG + Intergenic
1112665502 13:101567728-101567750 AAGTGTGACCAGGGATGGTATGG + Exonic
1112781329 13:102904169-102904191 AGGGGTGACGAGGGAGGAGAGGG + Intergenic
1113352573 13:109543844-109543866 AAGTGGTACTAGGCAGGAGATGG - Intergenic
1113877825 13:113605772-113605794 AAGTCAGTTCAGGGAGGAGAAGG + Intronic
1114477325 14:23005853-23005875 AAATGTGACTTGGGAGGAAAGGG - Intronic
1115960848 14:38835454-38835476 GAGCGTGCCCAGAGAGGAGAAGG + Intergenic
1116681408 14:47974479-47974501 AAGTGGGATCAGGGTGGAGGAGG + Intergenic
1117746230 14:58872323-58872345 ATGTTTGAACAGGGAGGAAATGG + Intergenic
1119415171 14:74465049-74465071 GAGAGTGCCCAGGGAGGAGCAGG - Intergenic
1120750787 14:88196004-88196026 AACTGTTATCAGGGAAGAGATGG + Intronic
1120914444 14:89698320-89698342 GATTCTGACCAAGGAGGAGAGGG - Intergenic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121493635 14:94377585-94377607 CCATGTGACTAGGGAGGAGAAGG + Exonic
1121699957 14:95945114-95945136 AAGTGAGAGAAGGGAGCAGAGGG - Intergenic
1121780178 14:96617248-96617270 AAATATGACCAGGGTGGGGAGGG + Intergenic
1122201851 14:100127633-100127655 AAGTGTGAGGAAGGAGGAAAAGG - Intronic
1122595089 14:102885023-102885045 CACTGTGGCCAGGGAAGAGAAGG - Intronic
1122626624 14:103088342-103088364 GAGTGTGAACAGGCAGGAGGCGG - Intergenic
1122974829 14:105166807-105166829 ACCTGTGATCAGGGAGTAGATGG - Intronic
1202835858 14_GL000009v2_random:76951-76973 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1124870036 15:33531751-33531773 AAGTGTATCCAAGTAGGAGATGG + Intronic
1126258111 15:46652140-46652162 AACTTGGACCAGGGAAGAGATGG + Intergenic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1126594622 15:50373045-50373067 AACTGGGACCTGGGAGGCGAAGG + Intergenic
1126998429 15:54473875-54473897 AAGGGTGACAAGGTAGGAGGGGG - Intronic
1127986553 15:64076859-64076881 AATAGAGACGAGGGAGGAGAGGG - Intronic
1128515219 15:68337799-68337821 AAGTGGGAACATGGAGGAGAGGG - Intronic
1128579135 15:68796643-68796665 AACAGTAACCAGGGAAGAGAAGG + Intronic
1128668555 15:69557018-69557040 GAGGGTGGTCAGGGAGGAGAGGG + Intergenic
1128778623 15:70342918-70342940 AAGCGTCACCTGGCAGGAGAGGG + Intergenic
1129062925 15:72874728-72874750 AAGTGTAGGCAGGGAGGAGTGGG - Intergenic
1131846863 15:96497416-96497438 AAGTGGGATCAGGGAGGCCAGGG + Intergenic
1132106041 15:99063496-99063518 AAGAGTGACCAGGAAAGACATGG - Intergenic
1132210650 15:100019845-100019867 AAGTGTGAGCTGGAGGGAGATGG - Intronic
1132481546 16:168781-168803 AGGTGTGAGCAGGGAGAGGAGGG - Intergenic
1132573378 16:653725-653747 AGCTGTGAACAGGGAGGAGGTGG - Exonic
1133727987 16:8555054-8555076 AGGAGAGACCTGGGAGGAGAGGG - Intergenic
1134214379 16:12305458-12305480 AAGTGTGCCCAGAGAAGTGAAGG - Intronic
1136019738 16:27432464-27432486 AGGTGGCACCAGGGATGAGAGGG - Intronic
1136246261 16:28977998-28978020 CAGTGTCACCAGGGACCAGAAGG - Exonic
1137359291 16:47798155-47798177 GACTGTGACCAGGGTGGTGATGG + Intergenic
1137582342 16:49640959-49640981 AAGGGACCCCAGGGAGGAGATGG + Intronic
1138127619 16:54451967-54451989 AAATTTGAGGAGGGAGGAGAAGG + Intergenic
1138423133 16:56912811-56912833 AGGAGTGATCAGGGAGGAGGTGG + Intronic
1138672834 16:58629557-58629579 AAGTGGGACGAGGCGGGAGAGGG - Intronic
1139549264 16:67664458-67664480 GAGTGTGTCCAGGAAGCAGATGG - Intronic
1140445897 16:75027672-75027694 AAGTGTGACAAGGCAAAAGAGGG - Intronic
1140906165 16:79411094-79411116 AAATGGGACAAGGGAGGAGTTGG - Intergenic
1141458449 16:84161117-84161139 ACGTGCGCCCAGGGAGGTGAGGG - Intronic
1141860077 16:86710548-86710570 AGGGGTGGCCAGGGAGGAGCTGG - Intergenic
1142122847 16:88395692-88395714 CTGTGTGACCAGCAAGGAGAAGG + Intergenic
1142197736 16:88746475-88746497 CAGACTGAACAGGGAGGAGAGGG - Intronic
1142607584 17:1090653-1090675 AGGAGTGTCCAGGCAGGAGAGGG + Intronic
1143385610 17:6528412-6528434 AAGAGAGAACAGGGAGGGGAGGG - Intronic
1143858326 17:9869406-9869428 AAGTGAGACTGGGCAGGAGAGGG - Intronic
1144100299 17:11937046-11937068 AAGAGTCATCAGGGAGGAGTGGG + Intronic
1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG + Intronic
1146411501 17:32589526-32589548 AAGTGTGACAGGGGAGAGGAAGG + Intronic
1146457791 17:33020783-33020805 AGGTGGGACCTGGGAGGTGAGGG - Intronic
1147038068 17:37696487-37696509 GAGTGTGAGCAGGAGGGAGAAGG - Intronic
1147573470 17:41585689-41585711 ATGTGGGAGCAGGGAGGAGGGGG + Intronic
1148317242 17:46712804-46712826 AAGAGTAACCAGAGAGGAAAGGG + Intronic
1148732664 17:49846992-49847014 AAGTGTGTGCAGTGAGGAGAGGG - Intronic
1148838674 17:50480132-50480154 GAATGTGACCAAAGAGGAGATGG - Intronic
1148960630 17:51389711-51389733 AACTGAGGCCAGAGAGGAGAAGG + Intergenic
1150218951 17:63485065-63485087 AAGTGGGACCATGCAGGGGAGGG + Exonic
1150711710 17:67536045-67536067 AACTGAGCCCAGGAAGGAGAGGG + Intronic
1151381257 17:73727280-73727302 AGGTGTGTCCAGAGAAGAGAGGG + Intergenic
1152071787 17:78137784-78137806 CAGGGTGACCAGGAAGGCGAAGG - Exonic
1152130425 17:78472823-78472845 AAGGGTGACCTGGGTGGAGCTGG - Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1152708574 17:81858903-81858925 GAGACTGACCAGCGAGGAGAGGG - Intronic
1153992243 18:10410864-10410886 AAGTGTGAACAAGTGGGAGAAGG - Intergenic
1154383571 18:13873309-13873331 CAGTGTGCCCAGGAAGGAAAGGG + Intergenic
1154389559 18:13924662-13924684 AGGTGGGGTCAGGGAGGAGAAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155615941 18:27721480-27721502 AAGAGAGAGGAGGGAGGAGAAGG + Intergenic
1157620918 18:49017120-49017142 GTGTGTGTTCAGGGAGGAGAGGG + Intergenic
1157853896 18:51085708-51085730 AGTTGTGACGTGGGAGGAGATGG - Intergenic
1158992683 18:62886200-62886222 AAGTGGGGACAGGGAAGAGATGG - Intronic
1159024386 18:63169122-63169144 AAGTGTCACCAGGGATGATCAGG - Intronic
1159703935 18:71663532-71663554 CAGTGTGGCCATGGAGGTGATGG + Intergenic
1159915443 18:74183350-74183372 ACATGAGACCAGGGAGTAGAAGG - Intergenic
1160059990 18:75521081-75521103 AAGTGTGTCCAGGGTAGAGCAGG + Intergenic
1160585707 18:79912130-79912152 GAGTGGGAGCAGGGAGGGGACGG + Intronic
1161057544 19:2198275-2198297 AGGTGTGGAGAGGGAGGAGACGG + Intronic
1161359400 19:3838823-3838845 CATCGGGACCAGGGAGGAGACGG - Intronic
1161723289 19:5915207-5915229 CAGTGTGACCTGGGAACAGAGGG - Exonic
1162308122 19:9888045-9888067 AAGTGAGGGCAGGGAGGTGATGG - Intronic
1162765322 19:12915843-12915865 AAGTGTGGGCAGGGTGGGGAAGG - Intronic
1162856129 19:13469866-13469888 AAGGTTGACAAGGCAGGAGAGGG - Intronic
1163170154 19:15525561-15525583 AAGTGTGGCCAGGCAGGACTGGG + Intronic
1163844526 19:19630725-19630747 AAGTGAGACCAAAGAGGAGTGGG + Intronic
1164156672 19:22601565-22601587 AACGGTGACCTGGGAGTAGAGGG + Intergenic
1164621734 19:29700076-29700098 AAAAATGCCCAGGGAGGAGATGG - Intronic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1164974385 19:32560892-32560914 AAGTCTGGCCAGGGAGAAGGGGG + Intergenic
1165334165 19:35157337-35157359 AGGTTTCACCAGGGAGGCGAGGG + Intronic
1165384084 19:35500294-35500316 AAGTGTTACTTGGGAGGTGAGGG + Intronic
1165467588 19:35984151-35984173 ATGGGTGACCGGGGAGTAGATGG - Intergenic
1165733002 19:38158427-38158449 AACTGAGATCAGGGAGGGGACGG + Intronic
1165894948 19:39136031-39136053 AGGTGTGACCAGGAAGGGGGTGG - Intronic
1165899327 19:39161539-39161561 AAGGGGGACCAGGGAGGAGGAGG - Intronic
1165997295 19:39853280-39853302 ATGTTTGAAAAGGGAGGAGAGGG + Intergenic
1166177725 19:41086734-41086756 AGGTGTGTCCAGGGAGGGAAAGG - Intergenic
1166196612 19:41210352-41210374 AGGTGTGACCAGCTAGGAGGTGG - Intergenic
1166438445 19:42789439-42789461 CAGTGTGAGCAGGAAGGAAATGG + Intronic
1166467333 19:43044088-43044110 CAGTGTGAGCAGGAAGGAAATGG + Intronic
1166473468 19:43100173-43100195 CAGTGTGAGCAGGAAGGAAATGG + Intronic
1166494259 19:43287177-43287199 AAGTGTGAGCAGAAAGGAAACGG + Intergenic
1166773434 19:45298117-45298139 CAGTGTGAGGAGGGAGGTGAGGG - Intronic
1168145555 19:54418644-54418666 GACAGTGAGCAGGGAGGAGAGGG + Intronic
1168700688 19:58437663-58437685 CAGTGTGAACAGGGAGGGGTTGG - Intronic
1202636779 1_KI270706v1_random:50412-50434 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
925161489 2:1687238-1687260 CAGGGTGCCCGGGGAGGAGAGGG - Intronic
926247915 2:11134100-11134122 AAGTGTGACCAGCGGTAAGAAGG + Intronic
927075607 2:19573996-19574018 CACTGTGACCACAGAGGAGAGGG + Intergenic
927333812 2:21897149-21897171 GACTGTGAGAAGGGAGGAGAGGG + Intergenic
927876216 2:26656952-26656974 GAGGGTGACCAGGGAGGAGGGGG + Intergenic
928299819 2:30115248-30115270 AGGAGGGAACAGGGAGGAGATGG - Intergenic
928387647 2:30883927-30883949 AATTGGGAGGAGGGAGGAGAGGG + Intergenic
929530872 2:42751599-42751621 AACCGTGGCCAGGGTGGAGAAGG + Intronic
929979243 2:46663516-46663538 CAGTGTCACCAGGGAGCATATGG - Intergenic
931429697 2:62198027-62198049 AAGTCTGAGCAGGGAGGAAAAGG - Intronic
932125582 2:69142817-69142839 AAGTGTGAGGAGGGAGGGGGAGG + Intronic
932598162 2:73107029-73107051 AATGGTGGCCAGAGAGGAGAGGG - Intronic
933079933 2:77973060-77973082 AAGTGTGCCCAAGGAGGTCAGGG - Intergenic
933395870 2:81730457-81730479 AGGTGTGACCTGGAAAGAGATGG - Intergenic
933983936 2:87575272-87575294 AAGTGGGGCCTGGGTGGAGAGGG - Intergenic
934998812 2:98990719-98990741 ATGTGTAATCAGGCAGGAGAAGG - Intergenic
935587998 2:104818769-104818791 ATGTGTGACCTGGTAGGGGAAGG - Intergenic
936166233 2:110122118-110122140 AAGTGTGCCCAGGCAGCTGATGG + Intergenic
936309919 2:111375524-111375546 AAGTGGGGCCTGGGTGGAGAGGG + Intergenic
937228195 2:120381835-120381857 AAGGGTGACCAGGGAGCAGCCGG + Intergenic
937271130 2:120653766-120653788 AAATGAGACCATGGAGGTGAAGG + Intergenic
937470651 2:122171327-122171349 AAGTCTGACCAAGCAGGAGATGG + Intergenic
937509805 2:122582951-122582973 AAGGAGGACCAGGGAGGGGAGGG + Intergenic
940073472 2:149715477-149715499 CAATGTGACCATGGAGGAGGAGG - Intergenic
941440787 2:165532707-165532729 CAGGGTGATCAGGCAGGAGAAGG + Intronic
941916535 2:170817234-170817256 AAGAGTGACGAGGGAGGCGGGGG - Intronic
944067062 2:195630376-195630398 TAGTGTGCCCAGGGAGGGCATGG - Intronic
944600399 2:201297476-201297498 AGGTGTGACCAATGAGGTGAAGG + Intronic
944848494 2:203692617-203692639 AAATATGACCAGGGTTGAGAGGG - Intergenic
945292845 2:208142980-208143002 AGGTGTGGCCAGGGAGGTGTAGG - Intronic
945497979 2:210533098-210533120 TAGTGTGACCATGAAGGACAGGG + Intronic
945994372 2:216423569-216423591 AAGTGTGATCACGTAGCAGAAGG + Intronic
946965377 2:225031531-225031553 AGGTGTGAGCAGGGAGAAGGAGG + Intronic
948315739 2:237027075-237027097 CAGTGTGTCCAGGGACAAGAAGG + Intergenic
948405535 2:237715613-237715635 AGGTGTGCCCAGGGAAGGGAAGG + Intronic
948438226 2:237967852-237967874 AACTGAGCCCAGGGAGGGGAAGG - Intronic
948530166 2:238599158-238599180 TAGTGGGACCAGGGAGGAGAAGG + Intergenic
948696583 2:239735986-239736008 AAGTGTGACCAGGCAGCATGGGG + Intergenic
1168781327 20:493337-493359 CAGTGAGACCAGTTAGGAGAAGG - Intronic
1169183727 20:3594019-3594041 AAATGTGACCATCGTGGAGAAGG + Intronic
1170178640 20:13502619-13502641 ATTTGTGACAAGGTAGGAGAGGG + Intronic
1171880892 20:30616828-30616850 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
1172224836 20:33298467-33298489 AAGGGCGACCAGAGAGGAGAAGG + Intronic
1172785284 20:37464585-37464607 AAGGGTGCCCAGGAAGGAGGGGG - Intergenic
1173176364 20:40767776-40767798 AGGGATGACCAGGGTGGAGAGGG - Intergenic
1173654937 20:44693445-44693467 GGGTGCGAGCAGGGAGGAGAAGG - Intergenic
1174424726 20:50423806-50423828 AAGTGAGCCCTGGGAGGGGAGGG + Intergenic
1174602493 20:51736038-51736060 ATGGGTGGCCAGGGAGGTGAGGG + Intronic
1175531207 20:59675039-59675061 AAGGAGGAACAGGGAGGAGAAGG - Intronic
1175682573 20:61001369-61001391 TAGTGTGACCATGGCAGAGAAGG + Intergenic
1175743339 20:61435969-61435991 AAGTGTGGCCAGACTGGAGAAGG - Intronic
1176842157 21:13850101-13850123 AAGCGGGACCTGGGAGAAGAGGG + Intergenic
1179142857 21:38741980-38742002 ATCTTTGTCCAGGGAGGAGAAGG - Intergenic
1179648820 21:42793362-42793384 AAGAGTGTCCAGGGAGCAGCTGG - Intergenic
1180159858 21:45994182-45994204 CAGGGTGATCAGGGAAGAGAAGG + Exonic
1180237511 21:46472572-46472594 ATGTGTGAAGAGGGTGGAGAAGG + Intronic
1180364092 22:11923901-11923923 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1181172153 22:21015796-21015818 AAGTGGGGCCAGAGAGGAGGTGG + Intronic
1181395363 22:22617610-22617632 AAGAGTGACCAGGGAAAACAAGG + Intergenic
1182440614 22:30361871-30361893 AAGGCTGTCCAGGAAGGAGAAGG - Intronic
1182453545 22:30435279-30435301 ATGGGGGCCCAGGGAGGAGAGGG - Intergenic
1182599461 22:31449407-31449429 ACCTGTGACAAGGGAGGAGAGGG + Exonic
1182621273 22:31620040-31620062 AACTGGGCCCAGGGAGGACAGGG + Intronic
1182768397 22:32775432-32775454 AAGTGGGAACAGGGAGGACCAGG - Intronic
1183404713 22:37624792-37624814 AGGTGAGACCAGGGAGGTGGCGG + Intronic
1183618532 22:38959464-38959486 AAGTGTGGGGAGGGAGGAGGAGG + Intronic
1183677805 22:39309542-39309564 AAGTGGGAACAGGGAGGTGGTGG - Intergenic
1184108853 22:42383748-42383770 AAATGTGCCCAGGGAGGGGGGGG - Exonic
1184271600 22:43387597-43387619 AACTGAGGCCAGGGAGGAGATGG + Intergenic
1185046157 22:48529639-48529661 GAGGGTGTCCAGGCAGGAGATGG + Intronic
1185272840 22:49936566-49936588 AAGTGTGACCTGGGTGGGGCGGG - Intergenic
1185281754 22:49972645-49972667 CAGTGGGACCAGGGAGGAGGAGG - Intergenic
949093355 3:56103-56125 AAGAGTAAACAGGGAGGACATGG + Intergenic
949248547 3:1954814-1954836 AAGTGGGACAAGTGAGGAGATGG - Intergenic
950470844 3:13185335-13185357 AGGTGTGACCAGGGAGGGCAGGG - Intergenic
950544751 3:13631752-13631774 AAGCCTGCCCAGTGAGGAGACGG + Intronic
952163149 3:30716097-30716119 AACTGGGACCTGGGAGGAGGAGG + Intergenic
953030187 3:39174902-39174924 AAGTGTGTCTAGGAAGGGGAAGG - Intergenic
953609449 3:44435257-44435279 AAGGCTGTCCAGTGAGGAGATGG - Intergenic
953663100 3:44905379-44905401 AAGTGTGCCCAGGGACCAGCCGG + Intronic
954286250 3:49621436-49621458 AGGTGTGGCCAGGCAGGAGGAGG + Intronic
956720204 3:72110754-72110776 AAGTGTAAACAGGGAAGAGGTGG + Intergenic
957033608 3:75272181-75272203 AAGGGTAAACAGGGAGGACATGG + Intergenic
958853704 3:99358892-99358914 AAGAATGACAAGGGAAGAGAAGG - Intergenic
959292791 3:104495690-104495712 ATCTGTGGCCAGGGAGCAGAAGG - Intergenic
959538336 3:107512439-107512461 AAGTATGACTGGAGAGGAGAAGG + Intergenic
960641269 3:119825956-119825978 ACTAGTGACCTGGGAGGAGATGG - Intronic
961061461 3:123832290-123832312 AAGTGTCTGAAGGGAGGAGAAGG - Intronic
961093641 3:124136778-124136800 GAGTGTGACCTGGGAAAAGATGG + Intronic
961491013 3:127257020-127257042 CAGGGTGGCCAGGGAGGAGGCGG - Intergenic
961749287 3:129085998-129086020 AAATGTGTGCAGGGAGGAGTGGG + Intergenic
962031975 3:131610664-131610686 AATTAGGACCAGAGAGGAGAAGG - Intronic
962326727 3:134440656-134440678 TGGTGTGACCAGGGAGGGCATGG - Intergenic
962678493 3:137774239-137774261 AAGTGAGACCAGGAAGAAGCAGG - Intergenic
963623646 3:147643832-147643854 AAGGCATACCAGGGAGGAGAGGG + Intergenic
963936593 3:151060293-151060315 AAGTGAGAACAGGGAAGAAATGG + Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
964602732 3:158519932-158519954 AATTGTGACCAGTGAGGAAAAGG + Intronic
966515961 3:180821159-180821181 CACAGTGACCAGGGAGGAGCTGG - Intronic
966996311 3:185283782-185283804 AAATGATACCAGGGAGGAGTTGG + Intronic
967186398 3:186948269-186948291 AAGAGGGACCAGGAAGGATAGGG + Intronic
967842648 3:194019216-194019238 AAGTGTAACCAGGAGGGTGATGG - Intergenic
967897226 3:194407532-194407554 CAGCGGGGCCAGGGAGGAGAGGG - Intronic
968052571 3:195665417-195665439 AAGTGTGTGGTGGGAGGAGACGG + Intergenic
968103240 3:195982937-195982959 AAGTGTGTGGTGGGAGGAGACGG - Intergenic
968301547 3:197620515-197620537 AAGTGTGTGGTGGGAGGAGATGG - Intergenic
968443461 4:636275-636297 ACGAGTGAGCAGGGAGCAGAGGG + Intronic
968977844 4:3831110-3831132 CAGTGAGACCAGGAAGGGGAGGG + Intergenic
969268977 4:6086028-6086050 AGTTGTGGCCAGGCAGGAGAGGG - Intronic
969429565 4:7146234-7146256 AAGTGTGGGCAGGGAGGAGAGGG + Intergenic
969934305 4:10666035-10666057 AAATATGGCCAGAGAGGAGAAGG + Intronic
971565442 4:28133353-28133375 AAGGGTGAGTAGGTAGGAGATGG - Intergenic
972599611 4:40560579-40560601 ATGTATGACTAGGCAGGAGAGGG - Intronic
973394025 4:49578653-49578675 AAGCGGGACCTGGGAGAAGAGGG - Intergenic
973680199 4:53309474-53309496 AAGTGTGACCACAGAGGATTAGG + Intronic
973810671 4:54566941-54566963 AGGTGTGACCAGGAAGAACAGGG + Intergenic
974551384 4:63379671-63379693 AAGGGTGAGCAAGGTGGAGATGG - Intergenic
975065177 4:70052859-70052881 AAGTGGGACTAGGGAGGCTAAGG + Intronic
976115637 4:81722963-81722985 AGGTGGGCCCAGAGAGGAGAGGG - Intronic
977223863 4:94371578-94371600 AAGAGTGACCAGTGAGGAATAGG + Intergenic
980595882 4:134953230-134953252 AAGTATGCCCAGCAAGGAGAGGG + Intergenic
980601451 4:135030960-135030982 AACTGGGACCAGGGAGGTGGAGG - Intergenic
981374666 4:144000211-144000233 AACTGTGACCAAGAAAGAGAAGG - Intronic
981384994 4:144119514-144119536 AACTGTGACCAAGAAAGAGAAGG - Intronic
981555205 4:145985865-145985887 AAGTGTGATCATATAGGAGAAGG - Intergenic
981608057 4:146561545-146561567 ATGTTTTACCAGCGAGGAGAAGG - Intergenic
982275332 4:153631828-153631850 CAGTGTAGCCAGGAAGGAGAGGG - Intronic
983406403 4:167336260-167336282 AAGGGAGACCAGTGAGTAGAAGG - Intergenic
984710651 4:182881331-182881353 GGGTGGGAGCAGGGAGGAGAGGG - Intergenic
984753113 4:183297767-183297789 AAGAGAGACAAGGGAGGAGATGG + Intronic
1202764094 4_GL000008v2_random:136283-136305 AAGCGGGACCAGGGAGAAGAGGG + Intergenic
985930032 5:3050046-3050068 AAATGAGCCCAGGTAGGAGATGG - Intergenic
986262761 5:6162896-6162918 AAGTGTGAACAGGCTGGAGTTGG - Intergenic
987558348 5:19484576-19484598 AAGTGTGACCTGGGGGCAGGTGG - Intronic
988485651 5:31666188-31666210 CTCTTTGACCAGGGAGGAGAAGG + Intronic
988666132 5:33329572-33329594 AAGGCTAACCTGGGAGGAGATGG + Intergenic
988925608 5:35988663-35988685 AAATGTGAACAGTGAGAAGATGG + Intronic
989412795 5:41139908-41139930 CAGTCTGACTAGGGAGAAGATGG - Intergenic
991111248 5:62902121-62902143 AACTGTGATAAGAGAGGAGAGGG + Intergenic
991465368 5:66906855-66906877 AAGGGTGTCCAGAGATGAGATGG + Intronic
994094810 5:95839133-95839155 AAGGGGGACCCAGGAGGAGAAGG + Intergenic
994247368 5:97494767-97494789 AAGTGTGACCAAGGAGTGGTAGG + Intergenic
994579853 5:101627919-101627941 AAGTCTTACCACGGTGGAGAAGG + Intergenic
995143788 5:108763594-108763616 AAATGTTTCCAGGGAGGGGAAGG + Intronic
995397798 5:111706438-111706460 CAGTTTGTCCAGGGTGGAGATGG + Intronic
996974092 5:129409350-129409372 AAATGTGAGGAGGGAGGAGATGG + Intergenic
997340726 5:133142486-133142508 CTGTGCGGCCAGGGAGGAGATGG + Intergenic
997361046 5:133295120-133295142 AAGTCTGAGGAGGGAGAAGAAGG - Intronic
998322663 5:141247074-141247096 AATGGAGACCAGGGAGGTGAGGG - Exonic
998850283 5:146345046-146345068 AAGTGGGAACAGGGCGGGGAAGG - Intergenic
999596771 5:153214143-153214165 AAGTGTGAATAGAGAGGAAAAGG + Intergenic
1001006296 5:168053392-168053414 AAGTGTGGCCAGTGAGGATATGG - Intronic
1001043238 5:168351908-168351930 AAGTGTGTCTTGGGTGGAGAGGG - Intronic
1001087789 5:168714019-168714041 AACTGTGAGGTGGGAGGAGAAGG - Intronic
1002060143 5:176621052-176621074 AGGTGGGAGCAGGGAGGAGAGGG - Intronic
1002102636 5:176864988-176865010 AACTGAGCCCAGGGAGGGGAGGG - Intronic
1003302090 6:4893054-4893076 CAGTGTGGCAAGTGAGGAGAAGG - Intronic
1003321612 6:5057331-5057353 AAGGGTGGGCAGGGAGGAGAGGG - Intergenic
1003669064 6:8139123-8139145 CAAAGTGACCAGGAAGGAGAGGG - Intergenic
1004273070 6:14212030-14212052 AGGTGGGAGCAGGGAGTAGAGGG - Intergenic
1004814948 6:19302807-19302829 AAGTGTCACAAGGAAGGAAAGGG - Intergenic
1005206235 6:23408437-23408459 AAGTGAGACCCACGAGGAGAAGG - Intergenic
1006002734 6:30978300-30978322 AAGGGGGATCATGGAGGAGAAGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007253295 6:40511037-40511059 AGGTGAGACCATGGGGGAGAAGG + Intronic
1007286306 6:40750000-40750022 AAGAGAGACCAGAGATGAGAAGG - Intergenic
1008030595 6:46689025-46689047 CAGTGCCACCTGGGAGGAGAGGG + Exonic
1008068863 6:47079283-47079305 AAGGGAGAGCAGGAAGGAGACGG + Intergenic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1010888341 6:81271838-81271860 AAATTTGACCAAGGAGGTGAAGG + Intergenic
1011203797 6:84869182-84869204 AGGTGTGACAAAGGAGAAGAAGG - Intergenic
1011811736 6:91140006-91140028 AAGTGTGATAAGGTAGGAGAGGG + Intergenic
1012248873 6:96958332-96958354 AACTGTGACCTGGGAGGATCAGG + Intronic
1012723368 6:102777727-102777749 CTGGGTGACCAGGGAGGACAAGG + Intergenic
1014077802 6:117256968-117256990 AAGTGTTAGCAGGGAAGATAAGG - Intergenic
1014709286 6:124787474-124787496 AAGGCTGACTAGGGAGGGGAAGG + Intronic
1015868667 6:137753784-137753806 AGGGGTGAACAGGGTGGAGAGGG + Intergenic
1017085730 6:150711043-150711065 AAGTCTGACTTGGGAGGAGTGGG + Intronic
1017254902 6:152322877-152322899 AAGTGTGAAAAGGGAGCTGAGGG - Intronic
1017468703 6:154718953-154718975 AAGTGTGACTAGGGAAGTTATGG + Intergenic
1017555453 6:155561223-155561245 AAATGTGAAGAGGGAGGAGAGGG + Intergenic
1018839657 6:167508428-167508450 AAGAGGGGACAGGGAGGAGAGGG - Intergenic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1019146168 6:169976794-169976816 AAGTGTGACCAGGGAGGAGGAGG - Intergenic
1019609371 7:1929192-1929214 AAGAGATACCAGGGAGGAGAAGG - Intronic
1020503418 7:8952718-8952740 AAGTGGCATCAGGTAGGAGATGG - Intergenic
1020657449 7:10944144-10944166 AACTGTTACCAGGGACTAGAAGG + Intergenic
1021611042 7:22458354-22458376 GATTGTAACCAGGGAGGAGGAGG + Intronic
1022113274 7:27244073-27244095 AAGTGGGACTAGGAAGGAAAGGG - Intronic
1022473334 7:30694869-30694891 AAGGAGGAGCAGGGAGGAGAGGG + Intronic
1023018195 7:35986388-35986410 AAGTGAGAGGAGGGAGAAGAAGG + Intergenic
1023878856 7:44307376-44307398 GGGTGTGAGCAGGGAGAAGAGGG + Intronic
1024054585 7:45651791-45651813 CTGAGTGACCAGGAAGGAGAGGG + Intronic
1024229909 7:47355863-47355885 AAGTGGGATGAGGGAGGGGAAGG + Intronic
1024517511 7:50271952-50271974 AAGAGTGACGAGGGTGGAGGAGG + Intergenic
1025806018 7:64835510-64835532 AAGAAGGACCAGGGTGGAGAGGG + Intergenic
1026152101 7:67796608-67796630 AAGTGTGACCAGCCTGGAGGTGG + Intergenic
1026829559 7:73602685-73602707 AAGGGGGACCAGGTGGGAGATGG + Intronic
1027270148 7:76514477-76514499 AGGTGAGGCCCGGGAGGAGAAGG - Intronic
1029050286 7:97679790-97679812 TGGTGTGCCCAGGGAGGGGATGG + Intergenic
1029103337 7:98152804-98152826 AGGTGAAAGCAGGGAGGAGATGG + Intronic
1030153273 7:106426973-106426995 AAGTGGGTCCAGAGAGGTGATGG + Intergenic
1032467611 7:132156272-132156294 AAGTCTGGCGAGGGAGTAGAGGG + Intronic
1032663551 7:134012529-134012551 AAGTGTGTGGAGGGCGGAGAGGG + Intronic
1032797404 7:135288902-135288924 AACTTTGGACAGGGAGGAGAGGG + Intergenic
1032810519 7:135410319-135410341 AAGTGTTACCAGGGAAAAGTAGG + Intronic
1033440254 7:141372070-141372092 AACTGGTACCAGTGAGGAGAAGG - Intronic
1033530924 7:142263311-142263333 AAGTTTGAGGAGAGAGGAGAGGG + Intergenic
1033643258 7:143282723-143282745 AACTGGGACCCGGGAGGCGAAGG - Intronic
1034369920 7:150585973-150585995 TAGAATGACCAGGGAGCAGAAGG - Intergenic
1034718953 7:153270277-153270299 CAGGGTGATCAGGCAGGAGAAGG + Intergenic
1035038087 7:155908374-155908396 AACTGAGGGCAGGGAGGAGAGGG - Intergenic
1035331270 7:158098782-158098804 AAGCGTGACCACCGAGGAGCTGG + Intronic
1035789628 8:2292240-2292262 AAGTGAGACCTCGGAGGAGAAGG - Intergenic
1035803177 8:2429465-2429487 AAGTGAGACCTCGGAGGAGAAGG + Intergenic
1035938333 8:3867909-3867931 AAGGGTGTCCAGGCAGGAGGCGG - Intronic
1036629493 8:10500762-10500784 AAGTGAGAAAAAGGAGGAGATGG + Intergenic
1036757339 8:11480047-11480069 GAGTGAGAGCAGGGAGGAGGAGG - Intergenic
1038420431 8:27430822-27430844 GAGTGAGACCTGGGAGGAGCAGG + Intronic
1038433169 8:27515931-27515953 AAGTGTGACCAGGTTGGGGCAGG + Intronic
1038556620 8:28523946-28523968 ATGTGGGGCCAGGGAGGAAAAGG - Intronic
1039102103 8:33951689-33951711 ACCTGGGACCAGGGAGGGGAGGG + Intergenic
1039424562 8:37475428-37475450 AGGTGTGAACAGCCAGGAGATGG + Intergenic
1039475737 8:37838595-37838617 GGGGGTGACCAGGAAGGAGAAGG - Intronic
1039948230 8:42148122-42148144 ACGTGTGAACAGGGAGGAAGTGG + Intergenic
1040626605 8:49157155-49157177 AGGAGTGAGCAGGGAGAAGATGG - Intergenic
1043566378 8:81553055-81553077 TAATGTGACCATGGTGGAGATGG + Intergenic
1044076665 8:87830960-87830982 AGGTATGACTTGGGAGGAGATGG - Intergenic
1044852412 8:96442005-96442027 AAGAGAGACCAGGCAAGAGATGG + Intergenic
1045312524 8:101015510-101015532 AGGAGAGACCAGGAAGGAGAGGG - Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1048609227 8:136003900-136003922 GAGTATGACCAGGGATCAGAGGG + Intergenic
1049043694 8:140132056-140132078 AGGTGTGACCAGGGAGGATCCGG - Intronic
1051185187 9:14452836-14452858 AACTGGAAGCAGGGAGGAGAAGG + Intergenic
1051563707 9:18472060-18472082 ATGTGTGAAGAGGGAGGAGGTGG + Intergenic
1051907576 9:22114216-22114238 AAGTTTGACCAGGTATAAGAGGG - Intergenic
1052049191 9:23825555-23825577 AAATGTGGCCAGGGGGGAGTAGG - Intronic
1052620750 9:30906038-30906060 ATGTGTGTATAGGGAGGAGAGGG + Intergenic
1052880610 9:33599162-33599184 AAGCGGGACCCGGGAGAAGAGGG - Intergenic
1053666825 9:40322974-40322996 AAGCGGGACCTGGGAGTAGAGGG - Intronic
1053916421 9:42948081-42948103 AAGCGGGACCTGGGAGTAGATGG - Intergenic
1054377977 9:64463002-64463024 AAGCGGGACCTGGGAGTAGAGGG - Intergenic
1054517784 9:66053309-66053331 AAGCGGGACCTGGGAGTAGAGGG + Intergenic
1054733530 9:68726646-68726668 ATGTGGCATCAGGGAGGAGAGGG + Intronic
1055985862 9:82056251-82056273 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1056836993 9:89963309-89963331 GGGAGTGACCAGGGAGGAAAGGG - Intergenic
1057675257 9:97132406-97132428 AAGTGGGACCCAGGAGAAGAGGG + Intergenic
1058425058 9:104868975-104868997 AGGTGGGAGGAGGGAGGAGAGGG + Intronic
1059508825 9:114824975-114824997 AAGTTCAAACAGGGAGGAGATGG + Intergenic
1060583298 9:124770835-124770857 GAGCGAGACCGGGGAGGAGAGGG + Intronic
1061190577 9:129080570-129080592 AACTGAGACCAGAGAGCAGAGGG - Intergenic
1062177677 9:135173265-135173287 AAGTGTGACTTGGGAGGTGGCGG + Intergenic
1062287034 9:135777908-135777930 AACTGGGAGCAGGGAGGAGCTGG - Intronic
1062287068 9:135778042-135778064 AGGAGTGACAAGGGAGGAGGGGG - Intronic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1185922983 X:4114571-4114593 AGGAGTGAGCAGTGAGGAGAAGG - Intergenic
1186167926 X:6846507-6846529 AAGTGAGAGCAGGTAGGAGAGGG - Intergenic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1187495908 X:19795503-19795525 AAATGTGAACATGGAGGAGGAGG - Intronic
1189169750 X:38897716-38897738 ATGTGTGAGGAGGAAGGAGAAGG - Intergenic
1189549763 X:42080728-42080750 ATGTGTGACCCGGGAGAAGGAGG + Intergenic
1189807574 X:44751076-44751098 AAGTCTGATAAGGGAGGAGATGG - Intergenic
1189830518 X:44968236-44968258 AACTGTGACCAGGGACAAGTTGG + Intronic
1192051121 X:67724835-67724857 AAGTCTGACCACTGAGAAGAAGG + Exonic
1192133140 X:68571696-68571718 GTGTGTGAGCAGGGAGGGGATGG + Intergenic
1192191878 X:68996015-68996037 AAGAGAGACAAGGGAGGAGGAGG + Intergenic
1194846552 X:98816484-98816506 AAGTGGGAACAGGAAAGAGAGGG + Intergenic
1195575747 X:106448710-106448732 AAGTGTGAGGAGGGATGGGAGGG + Intergenic
1195786146 X:108526138-108526160 AACTGGGAGCTGGGAGGAGAAGG + Intronic
1197895248 X:131306128-131306150 ATGTGTGACCAGGGGGGGTAAGG - Intronic
1198212739 X:134530551-134530573 GAGTCTGAGCAGGGAGGAGAGGG - Intergenic
1199445211 X:147912442-147912464 ATGAGAGACCAGCGAGGAGAGGG + Intronic
1199762135 X:150913029-150913051 CAGTGGGACCAGGGAGCAGCTGG - Intergenic
1201074766 Y:10178789-10178811 AAGTGGGGACAAGGAGGAGAGGG - Intergenic